nsv7093595
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NC_000019.9:g.1220363_1220364insGCCCGCAGGTACTT
CTTTTTTTTTTTTTTTTTTTTTNNNNNNNNNNGGCTGGCCGGGCAGAGTGGCTCCTCA
CTTCCCAGACGGGGTGGTTGCCAGACGGAGGGGCTCCTCACTTCTCAGACGGG AND Peutz-Jeghers syndrome - Publication(s):ACMG Board of Directors et al. 2014, Goggins et al. 2020, Green et al. 2013, Hampel et al. 2014, Kalia et al. 2016, McGarrity et al. 2001, Miller et al. 2021, Miller et al. 2022, No authors et al. 2020, No authors et al. 2021, No authors et al. 2021, Syngal et al. 2015, Trepanier et al. 2004
- ClinVar: RCV002872579.1
- ClinVar: VCV002033707.1
- GeneReviews: NBK1266
- MONDO: 0008280
- MeSH: D010580
- MedGen: C0031269
- OMIM: 175200
- Orphanet: 2869
- PubMed: 15604628
- PubMed: 20301443
- PubMed: 23788249
- PubMed: 25356965
- PubMed: 25394175
- PubMed: 25645574
- PubMed: 26389210
- PubMed: 26389258
- PubMed: 26389505
- PubMed: 27854360
- PubMed: 31672839
- PubMed: 34012068
- PubMed: 35802134
- Overlapping Genes
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 266 SVs from 33 studies. See in: genome view
Overlapping variant regions from other studies: 266 SVs from 33 studies. See in: genome view
Variant Region Placement Information
Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nsv7093595 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000019.10 | Chr19 | 1,220,364 | 1,220,364 |
nsv7093595 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000019.9 | Chr19 | 1,220,363 | 1,220,363 |
Variant Call Information
Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv18786014 | insertion | Multiple | Multiple | PEUTZ-JEGHERS SYNDROME; PJS; Peutz-Jeghers Syndrome; Peutz-Jeghers Syndrome; Peutz-Jeghers syndrome; Peutz-Jeghers syndrome | Pathogenic | ClinVar | RCV002872579.1, VCV002033707.1 |
Variant Call Placement Information
Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nssv18786014 | Submitted genomic | NC_000019.10:g.122 0364_1220365ins125 | GRCh38 (hg38) | NC_000019.10 | Chr19 | 1,220,364 | 1,220,364 |
nssv18786014 | Submitted genomic | NC_000019.9:g.1220 363_1220364ins125 | GRCh37 (hg19) | NC_000019.9 | Chr19 | 1,220,363 | 1,220,363 |
No validation data were submitted for this variant
Clinical Assertions
Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv18786014 | GRCh37: NC_000019.9:g.1220363_1220364ins125, GRCh38: NC_000019.10:g.1220364_1220365ins125 | insertion | germline | PEUTZ-JEGHERS SYNDROME; PJS; Peutz-Jeghers Syndrome; Peutz-Jeghers Syndrome; Peutz-Jeghers syndrome; Peutz-Jeghers syndrome | Pathogenic | ClinVar | RCV002872579.1, VCV002033707.1 |