nsv7093598
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_001042492.3(NF1):c.6813_6814insTTTTTTTTTTTT
TTTTTTTTNNNNNNNNNNTGACCTCATGATCCACCCGCCTCGGCCTCCCAAAGTGCTG
GGATTACAGGCGTGAGCCAACGCGCCCGGCCGATAATCCGTATTCTT (p.Ser2272delinsPhePhePhePhePhePheXaaXaaXaaXaaTer) AND Neurofibromatosis, type 1 - Publication(s):Botkin et al. 2015, Chen et al. 2010, Dome et al. 2003, Fishbein et al. 2021, Friedman et al. 1998, Lenders et al. 2014, Radtke et al. 2007, Radtke et al. 2020, Robson et al. 2010, Robson et al. 2015, Trepanier et al. 2004
- ClinVar: RCV002875628.1
- ClinVar: VCV002022538.1
- GeneReviews: NBK1109
- MONDO: 0018975
- MedGen: C0027831
- OMIM: 162200
- OMIM: 613113.0001
- OMIM: 613113.0002
- OMIM: 613113.0003
- OMIM: 613113.0004
- OMIM: 613113.0005
- OMIM: 613113.0006
- OMIM: 613113.0007
- OMIM: 613113.0008
- OMIM: 613113.0009
- OMIM: 613113.0012
- OMIM: 613113.0013
- OMIM: 613113.0014
- OMIM: 613113.0015
- OMIM: 613113.0016
- OMIM: 613113.0021
- OMIM: 613113.0022
- OMIM: 613113.0023
- OMIM: 613113.0024
- OMIM: 613113.0025
- OMIM: 613113.0026
- OMIM: 613113.0027
- OMIM: 613113.0029
- OMIM: 613113.0030
- OMIM: 613113.0031
- OMIM: 613113.0032
- OMIM: 613113.0037
- OMIM: 613113.0038
- OMIM: 613113.0040
- OMIM: 613113.0041
- OMIM: 613113.0042
- OMIM: 613113.0043
- OMIM: 613113.0044
- OMIM: 613113.0046
- Orphanet: 636
- PubMed: 15604628
- PubMed: 17636453
- PubMed: 20065170
- PubMed: 20301288
- PubMed: 20301471
- PubMed: 20664475
- PubMed: 24893135
- PubMed: 26140447
- PubMed: 26324357
- PubMed: 32602153
- PubMed: 33939658
- Overlapping Genes
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 127 SVs from 26 studies. See in: genome view
Overlapping variant regions from other studies: 127 SVs from 26 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093598 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000017.11 | Chr17 | 31,338,117 | 31,338,117 |
| nsv7093598 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000017.10 | Chr17 | 29,665,135 | 29,665,135 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786016 | insertion | Multiple | Multiple | NEUROFIBROMATOSIS, TYPE I; NF1; Neurofibromatosis 1; Neurofibromatosis type 1; Neurofibromatosis, type 1; See individual phenotypes in OMIM allelic variants | Pathogenic | ClinVar | RCV002875628.1, VCV002022538.1 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18786016 | Submitted genomic | NC_000017.11:g.313 38117_31338118ins1 17 | GRCh38 (hg38) | NC_000017.11 | Chr17 | 31,338,117 | 31,338,117 |
| nssv18786016 | Submitted genomic | NC_000017.10:g.296 65135_29665136ins1 17 | GRCh37 (hg19) | NC_000017.10 | Chr17 | 29,665,135 | 29,665,135 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786016 | GRCh37: NC_000017.10:g.29665135_29665136ins117, GRCh38: NC_000017.11:g.31338117_31338118ins117 | insertion | germline | NEUROFIBROMATOSIS, TYPE I; NF1; Neurofibromatosis 1; Neurofibromatosis type 1; Neurofibromatosis, type 1; See individual phenotypes in OMIM allelic variants | Pathogenic | ClinVar | RCV002875628.1, VCV002022538.1 |