Warning: The NCBI web site requires JavaScript to function. more...

dbVar

Database of genomic structural variation

nsv7093600

Organism: Homo sapiens

Study:nstd102 (Clinical Structural Variants)
Variant Type:insertion
Method Type:Multiple
Submitted on:GRCh37, GRCh38

Variant Calls:1
Validation:Not tested
Clinical Assertions: Yes
Region Size:1

Description:NM_007294.4(BRCA1):c.4806_4807insTATTGCGGCATTA
TTCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTA
ANNNNNNNNNNAAAAAAAAAAAAAAAAAAAAGAAAGTT (p.Pro1603delinsTyrCysGlyIleIleHisAsnSerLysAspLeuGluProThrGlnMetSerAsnAsnAspArgLeuAspTer) AND Hereditary breast ovarian cancer syndrome
Publication(s):ACMG Board of Directors et al. 2014, American College of Obstetricians and Gynecologists et al. 2009, American Society of Clinical Oncology et al. 2003, Berliner et al. 2007, Berliner et al. 2012, Berliner et al. 2021, Green et al. 2013, Kalia et al. 2016, Lu et al. 2014, Moyer et al. 2014, Nelson et al. 2013, Nelson et al. 2019, No authors et al. 2014, No authors et al. 2021, Petrucelli et al. 1998, Phillips et al. 2013, Robson et al. 2010, Robson et al. 2015, Saslow et al. 2007, Stratton et al. 2008, Trepanier et al. 2004, US Preventive Services Task Force et al. 2019

Links to Other Resources

Source: NCBI

Genome View
Variant Region Details and Evidence
Validation Information
Clinical Assertions
Genotype Information

Genome View

Select assembly:

Overlapping variant regions from other studies: 143 SVs from 28 studies. See in: genome view

Submitted genomic43,071,107-43,071,107

Variant Region Placement Information

Variant Region ID	Placement Type	Assembly	Assembly Unit	Sequence ID	Chr	Start	Stop
nsv7093600	Submitted genomic	GRCh38 (hg38)	Primary Assembly	NC_000017.11	Chr17	43,071,107	43,071,107
nsv7093600	Submitted genomic	GRCh37 (hg19)	Primary Assembly	NC_000017.10	Chr17	41,223,124	41,223,124

Variant Call Information

Variant Call ID	Type	Method	Analysis	Subject Phenotype	Clinical Interpretation	Source of Interpretation	ClinVar ID
nssv18786083	insertion	Multiple	Multiple	BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer; Breast-ovarian cancer, familial, susceptibility to; Hereditary Breast and Ovarian Cancer Syndrome; Hereditary breast and ovarian cancer syndrome; Hereditary breast and ovarian cancer syndrome	Pathogenic	ClinVar	RCV002852765.1, VCV002022810.1

Variant Call Placement Information

Variant Call ID	Placement Type	HGVS	Assembly	Sequence ID	Chr	Start	Stop
nssv18786083	Submitted genomic	NC_000017.11:g.430 71107_43071108ins1 09	GRCh38 (hg38)	NC_000017.11	Chr17	43,071,107	43,071,107
nssv18786083	Submitted genomic	NC_000017.10:g.412 23124_41223125ins1 09	GRCh37 (hg19)	NC_000017.10	Chr17	41,223,124	41,223,124

No validation data were submitted for this variant

Clinical Assertions

Variant Call ID	HGVS	Type	Allele Origin	Subject Phenotype	Clinical Interpretation	Source of Interpretation	ClinVar ID
nssv18786083	GRCh37: NC_000017.10:g.41223124_41223125ins109, GRCh38: NC_000017.11:g.43071107_43071108ins109	insertion	germline	BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer; Breast-ovarian cancer, familial, susceptibility to; Hereditary Breast and Ovarian Cancer Syndrome; Hereditary breast and ovarian cancer syndrome; Hereditary breast and ovarian cancer syndrome	Pathogenic	ClinVar	RCV002852765.1, VCV002022810.1

No genotype data were submitted for this variant

You are here: NCBI