nsv7093607
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_000138.5(FBN1):c.8512_8526A[5]GAAAGAACTTGGA
GGAGGAGCCAAGATGGCCGAATAGGAACAGCTCCGGTCTACAGCTCCCAGCGTGAGCG
ACGCAGAAGANNNNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAAGAAAGAACTT[1]
(p.Asn2843delinsGlyGlyGlyAlaLysMetAlaGluTer) AND multiple conditions - Publication(s):ACMG Board of Directors et al. 2014, Ades et al. 2006, Boodhwani et al. 2014, Dietz et al. 2001, Erbel et al. 2014, Green et al. 2013, Kalia et al. 2016, Loeys et al. 2010, Maron et al. 2004, Milewicz et al. 2003, Miller et al. 2021, Miller et al. 2022, Pyeritz et al. 2012, Tinkle et al. 2013, Zentner et al. 2017
- ClinVar: RCV003037781.1
- ClinVar: VCV002102751.1
- GeneReviews: NBK1335
- MONDO: 0007947
- MONDO: 0019625
- MedGen: C0024796
- MedGen: C4707243
- OMIM: 154700
- OMIM: PS607086
- Orphanet: 284963
- Orphanet: 558
- Orphanet: 91387
- PubMed: 15184297
- PubMed: 17188935
- PubMed: 20301299
- PubMed: 20301510
- PubMed: 20591885
- PubMed: 22237449
- PubMed: 23788249
- PubMed: 24081994
- PubMed: 24882528
- PubMed: 25173340
- PubMed: 25356965
- PubMed: 27854360
- PubMed: 28161018
- PubMed: 34012068
- PubMed: 35802134
- Overlapping Genes
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 83 SVs from 16 studies. See in: genome view
Overlapping variant regions from other studies: 83 SVs from 16 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093607 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000015.10 | Chr15 | 48,411,079 | 48,411,079 |
| nsv7093607 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000015.9 | Chr15 | 48,703,276 | 48,703,276 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786209 | insertion | Multiple | Multiple | Aortic aneurysm, familial thoracic; Familial thoracic aortic aneurysm and aortic dissection; MARFAN SYNDROME; MFS; Marfan Syndrome; Marfan syndrome; Marfan syndrome; Marfan syndrome type 1; Thoracic aortic aneurysm and aortic dissection | Pathogenic | ClinVar | RCV003037781.1, VCV002102751.1 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18786209 | Submitted genomic | NC_000015.10:g.484 11079_48411080ins1 16 | GRCh38 (hg38) | NC_000015.10 | Chr15 | 48,411,079 | 48,411,079 |
| nssv18786209 | Submitted genomic | NC_000015.9:g.4870 3276_48703277ins11 6 | GRCh37 (hg19) | NC_000015.9 | Chr15 | 48,703,276 | 48,703,276 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786209 | GRCh37: NC_000015.9:g.48703276_48703277ins116, GRCh38: NC_000015.10:g.48411079_48411080ins116 | insertion | germline | Aortic aneurysm, familial thoracic; Familial thoracic aortic aneurysm and aortic dissection; MARFAN SYNDROME; MFS; Marfan Syndrome; Marfan syndrome; Marfan syndrome; Marfan syndrome type 1; Thoracic aortic aneurysm and aortic dissection | Pathogenic | ClinVar | RCV003037781.1, VCV002102751.1 |