nsv7093617
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_025137.4(SPG11):c.6326_6327insCTTTTACACTGTT
GGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGGCGATTCCTCAGGGA
TCNNNNNNNNNNAAAAAAAAAAAAAAAAAAAAAAGATTTCCTCCGTTCCCCA (p.His2109_Gly2110insPheTyrThrValGlyGlyThrValAsnTer) AND Hereditary spastic paraplegia 11 - Publication(s):Stevanin et al. 2008
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 89 SVs from 23 studies. See in: genome view
Overlapping variant regions from other studies: 89 SVs from 23 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv7093617 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000015.10 | Chr15 | 44,572,699 | 44,572,699 |
| nsv7093617 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000015.9 | Chr15 | 44,864,897 | 44,864,897 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786074 | insertion | Multiple | Multiple | Autosomal recessive spastic paraplegia type 11; SPASTIC PARAPLEGIA 11, AUTOSOMAL RECESSIVE; SPG11; Spastic Paraplegia 11; Spastic paraplegia 11, autosomal recessive | Pathogenic | ClinVar | RCV002853427.1, VCV002025804.1 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv18786074 | Submitted genomic | NC_000015.10:g.445 72699_44572700ins1 23 | GRCh38 (hg38) | NC_000015.10 | Chr15 | 44,572,699 | 44,572,699 |
| nssv18786074 | Submitted genomic | NC_000015.9:g.4486 4897_44864898ins12 3 | GRCh37 (hg19) | NC_000015.9 | Chr15 | 44,864,897 | 44,864,897 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv18786074 | GRCh37: NC_000015.9:g.44864897_44864898ins123, GRCh38: NC_000015.10:g.44572699_44572700ins123 | insertion | germline | Autosomal recessive spastic paraplegia type 11; SPASTIC PARAPLEGIA 11, AUTOSOMAL RECESSIVE; SPG11; Spastic Paraplegia 11; Spastic paraplegia 11, autosomal recessive | Pathogenic | ClinVar | RCV002853427.1, VCV002025804.1 |