nsv7093618
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NM_001363711.2(DUOX2):c.2869_2870insTTTTTTTTTT
TTTTTTTTTTNNNNNNNNNNCTGACCTCATGATCCACCCGCCTCGGCCTCCCAAAGTG
CTGGGATTACAGGCGTGAGCCACCGCGCCCGGCCAGAGATATCTTTA (p.Lys957delinsIlePhePhePhePhePhePheXaaXaaXaaXaaAspLeuMetIleHisProProArgProProLysValLeuGlyLeuGlnAlaTer) AND not provided
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 93 SVs from 26 studies. See in: genome view
Overlapping variant regions from other studies: 93 SVs from 26 studies. See in: genome view
Variant Region Placement Information
Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nsv7093618 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000015.10 | Chr15 | 45,101,256 | 45,101,256 |
nsv7093618 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000015.9 | Chr15 | 45,393,454 | 45,393,454 |
Variant Call Information
Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv18786540 | insertion | Multiple | Multiple | not provided | Pathogenic | ClinVar | RCV002994310.1, VCV002081463.1 |
Variant Call Placement Information
Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
---|---|---|---|---|---|---|---|
nssv18786540 | Submitted genomic | NC_000015.10:g.451 01256_45101257ins1 15 | GRCh38 (hg38) | NC_000015.10 | Chr15 | 45,101,256 | 45,101,256 |
nssv18786540 | Submitted genomic | NC_000015.9:g.4539 3454_45393455ins11 5 | GRCh37 (hg19) | NC_000015.9 | Chr15 | 45,393,454 | 45,393,454 |
No validation data were submitted for this variant
Clinical Assertions
Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
---|---|---|---|---|---|---|---|
nssv18786540 | GRCh37: NC_000015.9:g.45393454_45393455ins115, GRCh38: NC_000015.10:g.45101256_45101257ins115 | insertion | germline | not provided | Pathogenic | ClinVar | RCV002994310.1, VCV002081463.1 |