Expression pattern

• This gene is expressed at moderate and approximately constant level at all stages of development, from embryo to adult\; this micro RNA is expressed in the soma, since its level is moderate also in glp-4 adults, which almost lack a germline [Lau and Bartel annotation]

Molecular properties

• [Ambros et al, RNA 2003] MicroRNAs (miRNAs) are small noncoding RNA gene products 20 to 25 nt long that are processed by Dicer (with 5'-phosphate and 3'-hydroxyl) from single stranded precursors with a characteristic hairpin secondary structure. They cannot reliably be distinguished from other RNAs such as small interfering RNAs also processed by Dicer, through their function or structure, but they can through a combination of expression properties: a distinct ~22-nt RNA transcript should be detectable by hybridization to a size-fractionated RNA sample\; biogenesis : MicroRNAs come from a single-molecule fold-back (hairpin) structure, not a hybrid between two antiparallel transcripts, and finally, in organisms with reduced Dicer function, increased precursor accumulation should occur. In the best cases, phylogenetic conservation of the ~22-nt miRNA sequence and its predicted fold-back precursor secondary structure is observed across distant species.
• [Wormbase] mir-60 encodes a microRNA that seems to be conserved in Drosophila and humans\; the mir-60 transcript is expressed most abundantly at the L1 stage of larval development.
• [This gene is annotated in collaboration with Nelson Lau and David Bartel] The mature miRNA sequence UAUUAUGCACAUUUUCUAGUUCA originates from the 3' end of the stem-loop sequence CTCGAAAACCGCTTGTTCTTGAACTGGAAGAGTGCCATAAAATCATGACAAAGTACGTGATATTATGCACATTTTCTAGTTCAAGACTTGAGAAATCG. The actual transcript is not known. The miRNA stem-loop sequence displayed corresponds to the foldback structure used to find and define the miRNAs and their homologs in other species. This miRNA is highly conserved in C. briggsae (>90\% identity).