Expression pattern

• This gene is expressed well at mid to late larval stages, L2, L3, L4 and adult, but not in embryos and L1 larvae\; this micro RNA is expressed in the soma, since its level is high in glp-4 adults, which almost lack a germline [Lau and Bartel annotation]

Molecular properties

• [Ambros et al, RNA 2003] MicroRNAs (miRNAs) are small noncoding RNA gene products 20 to 25 nt long that are processed by Dicer (with 5'-phosphate and 3'-hydroxyl) from single stranded precursors with a characteristic hairpin secondary structure. They cannot reliably be distinguished from other RNAs such as small interfering RNAs also processed by Dicer, through their function or structure, but they can through a combination of expression properties: a distinct ~22-nt RNA transcript should be detectable by hybridization to a size-fractionated RNA sample\; biogenesis : MicroRNAs come from a single-molecule fold-back (hairpin) structure, not a hybrid between two antiparallel transcripts, and finally, in organisms with reduced Dicer function, increased precursor accumulation should occur. In the best cases, phylogenetic conservation of the ~22-nt miRNA sequence and its predicted fold-back precursor secondary structure is observed across distant species.
• [Lau and Bartel, June 2005] The stem-loop sequence for the lin-4 gene is ATGCTTCCGGCCTGTTCCCTGAGACCTCAAGTGTGAGTGTACTATTGATGCTTCACACCTGGGCTCTCCGGGTACCAGGACGGTTTGAGCAGATCT.
• [Wormbase] lin-4 encodes a small noncoding temporal RNA (stRNA)\; lin-4 activity is required for regulating the timing of fate specification in neuronal and hypodermal lineages during postembryonic development\; in the hypodermis, lin-4 represses translation of the lin-14 and lin-28 mRNAs, and in the ventral nerve cord, lin-4 regulates the expression of hbl-1 mRNA\; lin-4 expression is temporally regulated, beginning at the end of the L1 larval stage and increasing to highest levels in adult animals\; lin-4 is conserved in mammals and Drosophila, where it is known as miR-125.
• [This gene is annotated in collaboration with Nelson Lau and David Bartel] The mature miRNA sequence UCCCUGAGACCUCAAGUGUGA originates from the 5' end of the stem-loop sequence ATGCTTCCGGCCTGTTCCCTGAGACCTCAAGTGTGAGTGTACTATTGATGCTTCACACCTGGGCTCTCCGGGTACCAGGACGGTTTGAGCAGATCT. The actual transcript is not known. The miRNA stem-loop sequence displayed corresponds to the foldback structure used to find and define the miRNAs and their homologs in other species. This miRNA is exactly conserved in C. briggsae (100\% identity).

Phenotype

• abnormal cell LINeage
• heterochronic
• Male mating abnormal
• male tail abnormal
• SLow growth
• Vulvaless
• [from C. elegans II book] Allele e912, induced by P32 decay: heterochronic, retarded adult hermaphrodites, long, abnormal movement, vulvaless, lack adult cuticle. Easy to score (adult), very hard (larvae)\; Hermaphrodites do not successfully mate (20C) \/ rarely do so (15C)\; adult males lack copulatory structures: they do not successfully mate. One other allele: ma161 (resembles e912). Cloned: encodes two small RNAs with no coding potential. [Lee et al. 1993\; Wightman et al. 1993\; Gary Ruvkun\; Victor Ambros]
• Allele e912, e92, n408, n409, n410