NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10726 Query DataSets for GPL10726
Status Public on Dec 31, 2010
Title Xenopus Gene Expression Microarray (AMADID: 015066)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Xenopus laevis
Manufacturer Agilent Technologies Inc.
Manufacture protocol Please see manufacturer's web site.
 
 
Submission date Jul 26, 2010
Last update date Dec 31, 2010
Contact name Akinori Ishihara
E-mail(s) saishih@ipc.shizuoka.ac.jp
Organization name Shizuoka University
Street address 0ya 836
City Shizuoka
ZIP/Postal code 422-8529
Country Japan
 
Samples (17) GSM570078, GSM570079, GSM570080, GSM570081, GSM570082, GSM570083 
Series (1)
GSE23154 Responsiveness of a premetamorphic Xenopus tadpole brain to hydroxylated PCBs

Data table header descriptions
ID
GB_ACC GenBank Accession number
RefSeq_ACC RefSeq Accession Number (http://www.ncbi.nlm.nih.gov/nuccore)
EntrezGene_ACC Entrez Gene Accession Number (http://www.ncbi.nlm.nih.gov/gene)
UniGene_ACC UniGene Accession Number (http://www.ncbi.nlm.nih.gov/unigene)
TIGR_ACC TIGR Accession Number (http://compbio.dfci.harvard.edu/cgi-bin/tgi/gireport.pl?gudb=xenopus)
NAME Gene Name
Symbol Gene Symbol
GO Gene Ontology Accession Number (http://www.geneontology.org/)
DESCRIPTION Description of probes
SEQUENCE Sequence of probes
SPOT_ID

Data table
ID GB_ACC RefSeq_ACC EntrezGene_ACC UniGene_ACC TIGR_ACC NAME Symbol GO DESCRIPTION SEQUENCE SPOT_ID
A_10_P000001 NM_001087487 NM_001087487 394301 Xl.429 TC362784 phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform ppp2r2b-a Xenopus laevis phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform (ppp2r2b-a), mRNA [NM_001087487] TTCTTCCTCGGTTTAGAATAGATAAACTTGCTTCTTAAATTCCCAGTAATCTCTATTCCG
A_10_P000002 NM_001090293 NM_001090293 399103 Xl.722 TC360697 activin type I receptor sax Xenopus laevis activin type I receptor (sax), mRNA [NM_001090293] GGTCTTGCATCCACGCCAAAGGCTGCTCGGACAATTTTGCAAATATTTTGGGTCTCTAAA
A_10_P000003 NM_001087708 NM_001087708 397696 Xl.783 TC362371 xlimk1 protein xlimk1 Xenopus laevis xlimk1 protein (xlimk1), mRNA [NM_001087708] TTGAACAACTTGAACAGAATTTCTGGGAAAACTACAGGAGGGGTGATAGCACACTTCACG
A_10_P000004 NM_001087712 NM_001087712 397698 Xl.815 TC358443 p100-NFkappaB2 LOC397698 Xenopus laevis p100-NFkappaB2 (LOC397698), mRNA [NM_001087712] GTGCCTTCATGTGTCTCACCCTGTGCGGAACTGCTGTGTCATTTGGACTATAATGTTTTT
A_10_P000005 NM_001085646 NM_001085646 373649 Xl.876 TC362159 v-yes-1 Yamaguchi sarcoma viral related oncogene homolog lyn-A Xenopus laevis v-yes-1 Yamaguchi sarcoma viral related oncogene homolog (lyn-A), mRNA [NM_001085646] GGCCTGTTTACTGGCGTTGCTTGTGCAGAGCTGGTGTCATAATCTTGACATATGGAAATA
A_10_P000006 NM_001087585 NM_001087585 394357 Xl.921 TC383507 20S proteasome alpha4 subunit psma4-B Xenopus laevis 20S proteasome alpha4 subunit (psma4-B), mRNA [NM_001087585] CCACATAATGGTCTGCACGTGGCACTGACATATTCATTGTGTTTAGGATTGGCTCTACAA
A_10_P000007 NM_001090695 NM_001090695 399344 Xl.336 TC403757 DUF87 SSRP1 Xenopus laevis DUF87 (SSRP1), mRNA [NM_001090695] CAGCACTCCAGCTAGCTCAGCTGAATCGGGTTCAGATTAATCAAGCCATCCCATAAAAAT
A_10_P000008 NM_001090697 NM_001090697 399345 Xl.7983 TC361446 DUF140 SUPT16H Xenopus laevis DUF140 (SUPT16H), mRNA [NM_001090697] ATTGTTTTCCTCGCTGCTGCTCTAAACTCAAGATATGGCTTTTTGATGCTTTCCCCCCTC
A_10_P000009 NM_001087619 NM_001087619 394375 Xl.7969 TC360512 Zic family member 3 heterotaxy 1 zic3-A Xenopus laevis Zic family member 3 heterotaxy 1 (zic3-A), mRNA [NM_001087619] ACGTCATGCAATGCTGAAACTAATGACAATATTCTGATTCTGCTGTATTAATTGGTCATC
A_10_P000010 NM_001090699 NM_001090699 399346 Xl.998 TC358083 vitellogenin receptor VLDLR Xenopus laevis vitellogenin receptor (VLDLR), mRNA [NM_001090699] CCTTTTTTATAGAGGTATGCAGAGGGTTTACTCCCTATTAAAACCACTGGAGAATCTTTT
A_10_P000011 NM_001090701 NM_001090701 399347 Xl.8760 TC358497 FGF receptor 3 FGFR3 Xenopus laevis FGF receptor 3 (FGFR3), mRNA [NM_001090701] TATTAATCAATTTCGAATGGTTCAAATTTAGGAGAGTTTTTAAAAATGGCGGCGACCACG
A_10_P000012 NM_001087720 NM_001087720 397702 Xl.1022 TC361952 alpha-2,8-polysialyltransferase LOC397702 Xenopus laevis alpha-2,8-polysialyltransferase (LOC397702), mRNA [NM_001087720] ATTTGATGTGATTGTCAGAACAATCAGAGTGCAAACATGCTCATCATGTATTTTCCATTC
A_10_P000013 NM_001085556 NM_001085556 373547 Xl.894 TC360132 Na+-glucose cotransporter type 1 (SGLT-1)-like protein sglt-1-like-a Xenopus laevis Na+-glucose cotransporter type 1 (SGLT-1)-like protein (sglt-1-like-a), mRNA [NM_001085556] TGTACTTTCCAGTGCTGCTTTTGTTAAACTTGTACAACGGAGTCCCATCCCGGATATTAT
A_10_P000014 NM_001090703 NM_001090703 399348 Xl.1033 TC360158 Prox 1 PROX1 Xenopus laevis Prox 1 (PROX1), mRNA [NM_001090703] TAGAAAATTAACTGGATATTCTCCCTTGCCCAGATAACTGGGAGGGGAGTTCTTTTACAT
A_10_P000015 NM_001085651 NM_001085651 373654 Xl.918 TC360761 mannose-binding protein-associated serine protease 2 masp2-A Xenopus laevis mannose-binding protein-associated serine protease 2 (masp2-A), mRNA [NM_001085651] ATGTGGCCTGAAACGTTGCCGTGATGCCCCTGTGAAGCACGAATAAAGGCATTTTAAATA
A_10_P000016 NM_001087724 NM_001087724 397704 Xl.1085 TC359166 Zic2 protein Zic2 Xenopus laevis Zic2 protein (Zic2), mRNA [NM_001087724] GTGACATGTTTTAAAAGTAATGCATACAGACCTCCTAATAAAATGTGTTGAAACTGCGAC
A_10_P000017 NM_001090297 NM_001090297 399105 Xl.2769 TC362299 XFGF-20 protein XFGF-20 Xenopus laevis XFGF-20 protein (XFGF-20), mRNA [NM_001090297] CCACCAATACCCAAGTCATGTTATTGATGTGTATGGATGCCTTAAAGTTTTGCCCATTGA
A_10_P000018 NM_001087889 NM_001087889 397792 Xl.903 TC383838 alpha-1-antiproteinase LOC397792 Xenopus laevis alpha-1-antiproteinase (LOC397792), mRNA [NM_001087889] TAGGCCTTTCCTGTTGACTATTTACGATATGGAGACAAAACACACCCTCTTTCTTGGAAG
A_10_P000020 NM_001085557 NM_001085557 373548 Xl.525 NP9455659 forkhead box D3 foxd3-A Xenopus laevis forkhead box D3 (foxd3-A), mRNA [NM_001085557] CTAAAAGCCAAGACTCTCAATGAACTTTTCTTGCTAAAACTGTACAGATCTGGAATGCAT
A_10_P000021 NM_001087736 NM_001087736 397710 Xl.1170 TC358570 contactin A LOC397710 Xenopus laevis contactin A (LOC397710), mRNA [NM_001087736] AGCGAAGGTGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGAGGTGCAACAGGGATT

Total number of rows: 21495

Table truncated, full table size 3991 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap