| Data table |
| ID |
Block |
Row |
Column |
GB_ACC |
GENE_ID |
SPOT_ID |
SEQUENCE |
Name |
description |
probe |
Archival BGI gene |
BGI gene |
geneid |
gene symbol |
gene description |
mRNA |
protein |
Nucleotide EST |
Nucleotide Core |
protein |
molecular_function |
biological_process |
cellular_component |
KEGG |
| 23857 |
1 |
1 |
1 |
CK556352 |
|
|
|
sw22934 |
gi|73695588|gb|AAZ80489.1| translation initiation factor 4A [Bombyx mori] |
sw22934 |
Contig309170GENE-1ALT-1 |
Bmb013675 |
692781 |
Eif-4a |
eukaryotic translation initiation factor 4A |
NM_001043911;DQ150250;DQ443290 |
NP_001037376;AAZ80489;ABF51379 |
|
|
O01955_BOMMO;Q1HPW2_BOMMO;Q285R3_BOMMO |
GO:0004386(helicase activity);GO:0003743(translation initiation factor activity);GO:0005524(ATP binding);GO:0003676(nucleic acid binding);GO:0008026(ATP-dependent helicase activity) |
|
|
|
| 23761 |
1 |
1 |
2 |
BB985916 |
733116 |
|
|
sw13956 |
gi|89268305|emb|CAJ81586.1| eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa [Xenopus tropicalis] |
sw13956 |
Bmb021881 |
Bmb021881 |
733116 |
LOC733116 |
eukaryotic translation initiation factor 3 subunit 5 |
DQ868530;DQ443287;NM_001047063 |
ABK42006;ABF51376;NP_001040528 |
|
|
Q1HPW5_BOMMO;A3QVV1_BOMMO |
GO:0003743(translation initiation factor activity) |
|
|
|
| 23809 |
1 |
1 |
3 |
CK556638 |
100101166 |
|
|
sw15061 |
gi|392868|gb|AAC46465.1| proteasome subunit |
sw15061 |
Bmb029812 |
Bmb029812 |
100101166 |
LOC100101166 |
proteasome beta subunit |
NM_001099622;DQ443234 |
NP_001093092;ABF51323 |
CK556638(rswla0_023166.y1 swl Bombyx mori cDNA, mRNA sequence);CK532391(rswga0_011844.y1 swg Bombyx mori cDNA, mRNA sequence);AU005791(AU005791 Bombyx mori p50(Daizo) Bombyx mori cDNA clone wv40109, mRNA sequence) |
NM_001099622(Bombyx mori proteasome beta subunit (LOC100101166), mRNA);CH388867(Bombyx mori strain Dazao Scaffold010344 genomic scaffold, whole genome shotgun sequence);DQ443234(Bombyx mori proteasome beta subunit mRNA, complete cds) |
Q1HQ18_BOMMO |
GO:0004298(threonine endopeptidase activity);GO:0004175(endopeptidase activity) |
GO:0006511(ubiquitin-dependent protein catabolism) |
GO:0005839(proteasome core complex (sensu Eukaryota));GO:0005829(cytosol);GO:0043234(protein complex) |
03050(Proteasome) |
| 23665 |
1 |
1 |
4 |
BB989792 |
|
|
|
sw01783 |
gi|70909753|emb|CAJ17302.1| ribosomal protein L19e [Cicindela campestris] |
sw01783 |
Bmb027924 |
Bmb027924 |
692696 |
Rpl19 |
ribosomal protein L19 |
DQ443429;AY769289;NM_001043756 |
ABF51518;AAV34831;NP_001037221 |
|
CH388005(Bombyx mori strain Dazao Scaffold009237 genomic scaffold, whole genome shotgun sequence);DQ443429(Bombyx mori PDP protein mRNA, complete cds);NM_001043756(Bombyx mori ribosomal protein L19 (Rpl19), mRNA) |
Q5UAR9_BOMMO |
GO:0003735(structural constituent of ribosome) |
GO:0006412(protein biosynthesis) |
GO:0005622(intracellular);GO:0005840(ribosome) |
03010(Ribosome) |
| 23713 |
1 |
1 |
5 |
BY927466 |
|
|
|
sw08699 |
gi|49532840|dbj|BAD26655.1| Ribosomal protein L27A2 [Plutella xylostella] |
sw08699 |
Bmb018161 |
Bmb018161 |
693067 |
Rpl27a |
ribosomal protein L27A |
AY769297;NM_001044057 |
AAV34839;NP_001037522 |
|
NM_001044057(Bombyx mori ribosomal protein L27A (Rpl27a), mRNA) |
Q5UAR1_BOMMO |
GO:0003735(structural constituent of ribosome) |
GO:0006412(protein biosynthesis) |
GO:0005622(intracellular);GO:0030529(ribonucleoprotein complex);GO:0005840(ribosome) |
03010(Ribosome) |
| 23617 |
1 |
1 |
6 |
|
|
--spot and immobilization positive control |
|
Hex |
immobilized control |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 23041 |
1 |
1 |
7 |
|
|
--negative control |
|
50%DMSO |
spot solution,50%DMSO |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 23905 |
1 |
1 |
8 |
|
|
--Yeast intergenic sequence 1, spike RNA |
|
Y1 |
Yeast intergenic sequence 1, spike RNA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 23953 |
1 |
1 |
9 |
|
|
--Yeast intergenic sequence 2, spike RNA |
|
Y2 |
Yeast intergenic sequence 2, spike RNA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 24001 |
1 |
1 |
10 |
|
|
--Yeast intergenic sequence 3, spike RNA |
|
Y3 |
Yeast intergenic sequence 3, spike RNA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 24049 |
1 |
1 |
11 |
|
|
--Yeast intergenic sequence 4, spike RNA |
|
Y4 |
Yeast intergenic sequence 4, spike RNA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 24097 |
1 |
1 |
12 |
|
|
--Yeast intergenic sequence 5, spike RNA |
|
Y5 |
Yeast intergenic sequence 5, spike RNA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 24145 |
1 |
1 |
13 |
|
|
--Yeast intergenic sequence 6, spike RNA |
|
Y6 |
Yeast intergenic sequence 6, spike RNA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 24193 |
1 |
1 |
14 |
|
|
--Yeast intergenic sequence 7, spike RNA |
|
Y7 |
Yeast intergenic sequence 7, spike RNA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 24241 |
1 |
1 |
15 |
|
|
--Yeast intergenic sequence 8, spike RNA |
|
Y8 |
Yeast intergenic sequence 8, spike RNA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 12 |
1 |
1 |
16 |
|
|
sw00193 |
ATCCTGGTCTCACGACAGCCTGGCGAGGTCCAGGAGAATCGTCGAGGTGAATTAAGTGAACCAGATTAA |
sw00193 |
|
sw00193 |
Bmb002775 |
Bmb002775 |
|
|
|
|
|
|
|
|
|
|
|
|
| 24 |
1 |
1 |
17 |
AT003836 |
|
|
TGCTTGGACGGTAGCCTCAGACCCAGGCTTAATCGATCTTCTATTATTTGTGGAAAAGAGCGAGCCTCG |
sw00001 |
|
sw00001 |
AT003836.1 |
|
|
|
|
|
|
AT003836(AT003836 Bombyx mori Bm5 Cell Tunicamycin Induced cDNA Library Bombyx mori cDNA clone TmInc186, mRNA sequence) |
|
|
|
|
|
|
| 108 |
1 |
1 |
18 |
|
|
sw00197 |
GTCGCGAAGCCGCCTCCACCCAAAACACCGAGCAAAGAAAGCGCCTACGAACTGAACAGCCGGAGATAA |
sw00197 |
gi|25012361|gb|AAN71290.1| RE08130p [Drosophila melanogaster] |
sw00197 |
Bmb002816 |
Bmb002816 |
|
|
|
|
|
|
|
|
|
GO:0007155(cell adhesion) |
GO:0016020(membrane) |
|
| 120 |
1 |
1 |
19 |
|
692798 |
sw00005 |
GTTTTCATGAGAATCAAACACAAACTGTGTTGTGAAGATCCACCTTTTGCCGGGGACATCCCCGGCTAA |
sw00005 |
gi|87248087|gb|ABD36096.1| cytidine deaminase [Bombyx mori] |
sw00005 |
Bmb000068 |
Bmb000068 |
692798 |
LOC692798 |
cytidine deaminase |
NM_001046645;DQ311151 |
NP_001040110;ABD36096 |
|
CH379593(Bombyx mori strain Dazao Scaffold000007 genomic scaffold, whole genome shotgun sequence);NM_001046645(Bombyx mori cytidine deaminase (LOC692798), mRNA);DQ311151(Bombyx mori cytidine deaminase mRNA, complete cds) |
Q2F6C1_BOMMO |
GO:0004126(cytidine deaminase activity);GO:0008270(zinc ion binding);GO:0016787(hydrolase activity) |
GO:0046087(cytidine metabolism) |
|
00240(Pyrimidine metabolism) |
| 204 |
1 |
1 |
20 |
|
|
sw00201 |
CGACACACGCACCCCAACAAGAACCACAAGGTGACCTCGCCGGGATCTCCGTACACCAAGCCGAAGTAA |
sw00201 |
|
sw00201 |
Bmb002843 |
Bmb002843 |
|
|
|
|
|
|
CH380005(Bombyx mori strain Dazao Scaffold000420 genomic scaffold, whole genome shotgun sequence) |
|
|
|
|
|
Less...
More...