NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10778 Query DataSets for GPL10778
Status Public on Dec 20, 2010
Title Agilent-019921 Sheep Gene Expression Microarray (Probe Name version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Ovis aries
Manufacturer Agilent
Manufacture protocol http://www.chem.agilent.com/en-US/Products/Instruments/dnamicroarrays/Pages/gp26041.aspx
 
Description *** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL10427.
 
Submission date Aug 11, 2010
Last update date Jan 08, 2013
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (261) GSM578016, GSM578017, GSM578018, GSM578019, GSM578020, GSM578021 
Series (18)
GSE23563 Profiles of gene expression in skeletal muscle in sheep from the middle gestation to postnatal stages
GSE45501 Genome array of hair follicle genes in lamp skin with different patterns
GSE49920 Antenatal maternal long-term hypoxia: acclimatization responses with altered gene expression in ovine fetal carotid arteries

Data table header descriptions
ID
GB_ACC GenBank Accession number
UniGene ID UniGene identifier
SPOT_ID
SEQUENCE
DESCRIPTION

Data table
ID GB_ACC UniGene ID SPOT_ID SEQUENCE DESCRIPTION
A_70_P059667 DQ239622 Oar.13339 GAAAAATATAAGCGAGCTCTAGCAGATACTGAGAACTTGCGGCAGAGGAGCCAAAAATTG gb|Ovis aries clone clone TO-UP-J12-5 stress-inducible chaperone mt-GrpE #1 mRNA, partial cds [DQ239622]
A_70_P038631 DY519331 Oar.5022 GATGGCTGGCATGAACATGCCTTTGAATTTGTCCCTGAAAAAATGAAAGGAATATTTAAA gb|sh3P0043M07_F.ab1 adult sheep fracture callus 10d Ovis aries cDNA, mRNA sequence [DY519331]
A_70_P054501 EE825718 Oar.9729 ATTGGCATTCTGTTCAGCAGGCATCTTTTTTGGCACAGTGGCAGAATGTGGTACATCTTC gb|020605ONLN123068HT ONLN Ovis aries cDNA, mRNA sequence [EE825718]
A_70_P056591 EE751979 Oar.6910 AGATGACTGCAAACGTGAAACCCTTCTTGAGCAGGCACAGTAGTAACGAGGTTATGATTG gb|020502OCSI1007092HT OCS1 Ovis aries cDNA, mRNA sequence [EE751979]
A_70_P062706 EE760800 Oar.10890 GGCTCTAAAGGTGAAATCTTTCATTTTTCCACCATGAACAGAAAATGATGCCAACTAAAA gb|021030OD15L029040HT OD15L Ovis aries cDNA, mRNA sequence [EE760800]
A_70_P047276 FE032239 Oar.8635 ATCTCCTGTATTGACAGGCAGATTCTTTATTTTTGTGCCACCTGGGAAGCCCAGTTAGTG gb|C0009479A15.P1KAM13F KN511 Ovis aries rectum and large colon from E. coli challenged and unchallenged animals Ovis aries cDNA clone C0009479A15 5', mRNA sequence [FE032239]
A_70_P050036 EE831339 Oar.3372 TATATTTCAGGGAATGTTAACTGTGGGGTGATGAATAGCAATGGCACGAAGTTCTCTCGG gb|020605ONLN012087HT ONLN Ovis aries cDNA, mRNA sequence [EE831339]
A_70_P020696 EE821245 Oar.3918 TGAAGATCCTCAAGCACTTCAAGCATGACAACATCATTGCCATAAAGGACATCCTGAGGC gb|020731ONDC279057HT ONDC Ovis aries cDNA, mRNA sequence [EE821245]
A_70_P006211 EE779128 Oar.11594 GCTTGGATTGTACAGAAATACCTATTAGTGGATAAGGCTTTTTTCTTTGAAAACTCTGGA gb|020709OMGB11077079HT OMGB1 Ovis aries cDNA, mRNA sequence [EE779128]
A_70_P061966 EE830099 Oar.10083 GGACATCCCACTGCTGGACAACGTCATCAATTACAGCTTCCCCGCCTAGGGCAAGCTCTT gb|020605ONLN026034HT ONLN Ovis aries cDNA, mRNA sequence [EE830099]
A_70_P070711 EE846867 Oar.10707 CATGGCCAAAGATGTCTCTATGCAGTCCTTCTAATAGATAGCTGTATTTTATTATGGTTG gb|010914OSAB012083HT OSAB Ovis aries cDNA, mRNA sequence [EE846867]
A_70_P061931 EE858489 Oar.10076 TAAAGTGTTGTCTACTGCATAACCAGTCGGCCTCACTTATGGTAAAGTGGAGATGCTCTG gb|020731OSTA167053HT OSTA Ovis aries cDNA, mRNA sequence [EE858489]
A_70_P061066 EE792896 Oar.13542 GGCGTGTATCCTTCATCAGCTCTACAGTTTCAATAAGGATTGGTCATTGTAAAGATAGAT gb|020709OMLT1006039HT OMLT Ovis aries cDNA, mRNA sequence [EE792896]
A_70_P064456 EE807465 Oar.12173 TTGCTGCATTGAACAGTAATAACTTTGTGCGATTTTTTAAACTGGTCCAATCAGCTTCTT gb|010914ONDC076052HT ONDC Ovis aries cDNA, mRNA sequence [EE807465]
A_70_P031801 FE035606 Oar.15199 CTGTATAAGTACAGGTGACAGAGTGGTCAGGAGAGTAAGACTGATAACTCATTCATGTTC gb|C0009483M11.P1KM13F KN511 Ovis aries efferent gastric lymph from uninfected sheep Ovis aries cDNA clone C0009483M11 5', mRNA sequence [FE035606]
A_70_P028321 EE751492 Oar.9036 AGGGAATGTGGATGTCTCCCAATGTTGATGAGTATACTTGTTTACTGGAATCCTAGATTA gb|020502OCSI1026029HT OCS1 Ovis aries cDNA, mRNA sequence [EE751492]
A_70_P054976 EE793379 Oar.11116 GTTCCTGAAAATTTGAATCATATACAGATAACTGGCTTATCTTGGTTATCAAGAAGCTGC gb|020314OMLT1001060HT OMLT Ovis aries cDNA, mRNA sequence [EE793379]
A_70_P049816 EE857094 Oar.3327 GAGAAGCCATGATTTCACCTAAAAATCCAGGGCCATAGGACCTGTGATTCTGAGATGTCT gb|020731OSTA133035HT OSTA Ovis aries cDNA, mRNA sequence [EE857094]
A_70_P030686 EE827462 Oar.5654 TCAAAAGAATAAGCTTCGACACCTATCGGTCGTCACCTTGGCTGCCAAAGTCAAGTGTAT gb|020605ONLN122083HT ONLN Ovis aries cDNA, mRNA sequence [EE827462]
A_70_P056731 EE849931 Oar.6939 GTCGCAGTTAGAGAATGAGGTTGACTAATGCATATTATGAATTGAGTCCACAAAAGAAAC gb|020829OSI1024086HT OSI Ovis aries cDNA, mRNA sequence [EE849931]

Total number of rows: 15068

Table truncated, full table size 2670 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap