NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10927 Query DataSets for GPL10927
Status Public on Dec 31, 2010
Title Agilent-026378 Genotypic Designed Candida Glabrata 16K Whole Genome Gene Expression Profiling Microarray
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Nakaseomyces glabratus CBS 138
Manufacturer Agilent Technologies
Manufacture protocol Refer to www.opengenomics.com
 
 
Web link http://www.genotypic.co.in/custom_microarrays.html
Contributor(s) Mugasimangalam RC, Shukla RN, Sinha S
Submission date Sep 16, 2010
Last update date Dec 31, 2010
Contact name Genotypic technology
E-mail(s) sudha.rao@genotypic.co.in
Organization name Genotypic Technology
Street address 259, Apoorva 4th cross,80 feet Road,RMV 2ND STAGE
City Bangalore
State/province Karnataka
ZIP/Postal code 560094
Country India
 
Samples (8) GSM596877, GSM596878, GSM596879, GSM596880, GSM596881, GSM596882 
Series (1)
GSE24267 Response of Candida glabrata to low pH

Data table header descriptions
ID
NAME PROBE NAME
PROBE_ID PROBE ID
CONTROL_TYPE HYBRDIZATION CONTROL TYPE
ORF ORF Name
GENE_SYMBOL GENE SYMBOL
ACCESSION_STRING GENE ID
DESCRIPTION GENE NAME
SEQUENCE PROBE SEQUENCE
SPOT_ID

Data table
ID NAME PROBE_ID CONTROL_TYPE ORF GENE_SYMBOL ACCESSION_STRING DESCRIPTION SEQUENCE SPOT_ID
1 GE_BrightCorner GE_BrightCorner pos --GE_BrightCorner
2 DarkCorner DarkCorner pos --DarkCorner
3 DarkCorner DarkCorner pos --DarkCorner
4 GT_CglaCBS138_Specific_02578 GT_CglaCBS138_Specific_02578 FALSE CAGL0H09966g CAGL0H09966g CAGL0H09966g CAGL0H09966g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 973025..973576 (+) In Candida glabrata CBS 138 Chromosome H, ProteinID: 50295404;50289597 ,Accessions: NC_006031 ; :: Next best hit, CAGL0D05676g(alignment 16bp with 100.00% identity), Description: hypothetical protein, Location: 538678..540639 (-) In Candida glabrata CBS 138 Chromosome D, ProteinID: 50286455;50295400 ,Accessions: NC_006027 GCGGCCATTGCTTCATTTTTGATGTATTGTTGCAAACAAAAGGTGAATTTGACAAGTTAG
5 GT_CglaCBS138_Specific_02117 GT_CglaCBS138_Specific_02117 FALSE CAGL0G09152g CAGL0G09152g CAGL0G09152g CAGL0G09152g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 873865..874680 (+) In Candida glabrata CBS 138 Chromosome G, ProteinID: 50295403;50288659 ,Accessions: NC_006030 ; :: Next best hit, CAGL0F01419g(alignment 13bp with 100.00% identity), Description: hypothetical protein, Location: 142623..146819 (-) In Candida glabrata CBS 138 Chromosome F, ProteinID: 50287207;50295402 ,Accessions: NC_006029 TTAATGAAAGGTGTCACAAACCCAACTCAAACTTACGGTAATGATGTCCTCAGCCGGGAG
6 GT_CglaCBS138_Specific_04793 GT_CglaCBS138_Specific_04793 FALSE CAGL0M02321g CAGL0M02321g CAGL0M02321g CAGL0M02321g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 276554..277990 (-) In Candida glabrata CBS 138 Chromosome M, ProteinID: 50294071;50295409 ,Accessions: NC_006036 ; :: Next best hit, CAGL0K06325g(alignment 15bp with 100.00% identity), Description: hypothetical protein, Location: 620720..622549 (-) In Candida glabrata CBS 138 Chromosome K, ProteinID: 50292131;50295407 ,Accessions: NC_006034 GGTGACGATTGTGATTTGGAAATGTCAGATGAAATTCTTCAAAAGTTACTGGAGTCTTTT
7 GT_CglaCBS138_Specific_03363 GT_CglaCBS138_Specific_03363 FALSE CAGL0J06974g CAGL0J06974g CAGL0J06974g CAGL0J06974g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 665687..667723 (+) In Candida glabrata CBS 138 Chromosome J, ProteinID: 50291153;50295406 ,Accessions: NC_006033 ; :: Next best hit, CAGL0F02673g(alignment 15bp with 100.00% identity), Description: hypothetical protein, Location: 258826..259341 (-) In Candida glabrata CBS 138 Chromosome F, ProteinID: 50287313;50295402 ,Accessions: NC_006029 CATGATATCTCATGTTTCAGTTGCAAGAAAGCACAATACAAGAAGTGGAAGAAAATGGTA
8 GT_CglaCBS138_Specific_01527 GT_CglaCBS138_Specific_01527 FALSE CAGL0F04433g CAGL0F04433g CAGL0F04433g CAGL0F04433g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 442206..443942 (+) In Candida glabrata CBS 138 Chromosome F, ProteinID: 50287469;50295402 ,Accessions: NC_006029 ; :: Next best hit, CAGL0M12298g(alignment 18bp with 100.00% identity), Description: hypothetical protein, Location: 1225753..1228737 (-) In Candida glabrata CBS 138 Chromosome M, ProteinID: 50295409;50294932 ,Accessions: NC_006036 CGGTATCTTAGATGATGTTATTGCTGGAAAATATGAATTCAATGGTGATGGTAAGTCTGA
9 GT_CglaCBS138_Specific_03405 GT_CglaCBS138_Specific_03405 FALSE CAGL0J07898g CAGL0J07898g CAGL0J07898g CAGL0J07898g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 768873..769340 (+) In Candida glabrata CBS 138 Chromosome J, ProteinID: 50291237;50295406 ,Accessions: NC_006033 ; :: Next best hit, CAGL0I03828g(alignment 13bp with 100.00% identity), Description: hypothetical protein, Location: 328922..334069 (-) In Candida glabrata CBS 138 Chromosome I, ProteinID: 50289967;50295405 ,Accessions: NC_006032 GAGAAGGTTTGTTATAACTGTAACGAAACTGGTCACATCTCTAGAGACTGCCCAGTTTTG
10 GT_CglaCBS138_Specific_02667 GT_CglaCBS138_Specific_02667 FALSE CAGL0I01562g CAGL0I01562g CAGL0I01562g CAGL0I01562g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 124905..125387 (+) In Candida glabrata CBS 138 Chromosome I, ProteinID: 50295405;50289779 ,Accessions: NC_006032 ; :: Next best hit, CAGL0G04565g(alignment 18bp with 100.00% identity), Description: hypothetical protein, Location: 434012..435706 (-) In Candida glabrata CBS 138 Chromosome G, ProteinID: 50295403;50288259 ,Accessions: NC_006030 TTGTACGGTTTGATTGTCGCTCTATTGATGAATTCCAGAGCTACTCAAGACGTTATCTGT
11 GT_CglaCBS138_Specific_04950 GT_CglaCBS138_Specific_04950 FALSE CAGL0M05951g CAGL0M05951g CAGL0M05951g CAGL0M05951g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 626330..626719 (+) In Candida glabrata CBS 138 Chromosome M, ProteinID: 50295409;50294388 ,Accessions: NC_006036 ; :: Next best hit, CAGL0F05665g(alignment 17bp with 100.00% identity), Description: hypothetical protein, Location: 567360..569354 (-) In Candida glabrata CBS 138 Chromosome F, ProteinID: 50287575;50295402 ,Accessions: NC_006029 TGGGAGAAGAAAGCACTGGGAACTGACCTACAGAGCATAAAGGAACTATTAGAAAAGGAC
12 GT_CglaCBS138_Specific_03562 GT_CglaCBS138_Specific_03562 FALSE CAGL0J11440g CAGL0J11440g CAGL0J11440g CAGL0J11440g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 1107553..1109184 (-) In Candida glabrata CBS 138 Chromosome J, ProteinID: 50291555;50295406 ,Accessions: NC_006033 ; :: Next best hit, CAGL0I09438g(alignment 15bp with 100.00% identity), Description: hypothetical protein, Location: 904616..905836 (+) In Candida glabrata CBS 138 Chromosome I, ProteinID: 50290451;50295405 ,Accessions: NC_006032 AATGCTGGTAATACTTTCGGTTTCGGTTCTAATGTCAACCAGCAATTCAACTTCAATTAA
13 GT_CglaCBS138_Specific_04081 GT_CglaCBS138_Specific_04081 FALSE CAGL0K11836g CAGL0K11836g CAGL0K11836g CAGL0K11836g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 1142213..1143781 (-) In Candida glabrata CBS 138 Chromosome K, ProteinID: 50292595;50295407 ,Accessions: NC_006034 ; :: Next best hit, CAGL0I06512g(alignment 14bp with 100.00% identity), Description: hypothetical protein, Location: 627769..634128 (+) In Candida glabrata CBS 138 Chromosome I, ProteinID: 50295405;50290203 ,Accessions: NC_006032 AACTGATTGGCGGAATGTGCTTACAGAAATTCATTCACAACGGAGTCGGTCTGCGCTTAT
14 GT_CglaCBS138_Specific_02751 GT_CglaCBS138_Specific_02751 FALSE CAGL0I03608g CAGL0I03608g CAGL0I03608g CAGL0I03608g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 306677..308464 (-) In Candida glabrata CBS 138 Chromosome I, ProteinID: 50295405;50289947 ,Accessions: NC_006032 ; :: Next best hit, CAGL0J05610g(alignment 16bp with 100.00% identity), Description: hypothetical protein, Location: 532159..536379 (-) In Candida glabrata CBS 138 Chromosome J, ProteinID: 50291033;50295406 ,Accessions: NC_006033 GTGCTTATGAGGGTGAAAAGACAGGTATCAAGAAGAATCTAACAAAATCGGTGAAATTCA
15 GT_CglaCBS138_Specific_04031 GT_CglaCBS138_Specific_04031 FALSE CAGL0K10604g CAGL0K10604g CAGL0K10604g CAGL0K10604g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 1029226..1030566 (-) In Candida glabrata CBS 138 Chromosome K, ProteinID: 50292491;50295407 ,Accessions: NC_006034 ; :: Next best hit, CAGL0E00473g(alignment 15bp with 100.00% identity), Description: hypothetical protein, Location: 44001..47078 (+) In Candida glabrata CBS 138 Chromosome E, ProteinID: 50286559;50295401 ,Accessions: NC_006028 GACAACAAACATTGGCACAAATAATAAAAGTTGCTACGGTCAATAAAGATACTGTACGGA
16 GT_CglaCBS138_Specific_00053 GT_CglaCBS138_Specific_00053 FALSE CAGL0A00429g CAGL0A00429g CAGL0A00429g CAGL0A00429g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 42636..44030 (-) In Candida glabrata CBS 138 Chromosome A, ProteinID: 50295397;50284727 ,Accessions: NC_005967 ; :: Next best hit, CAGL0E04950g(alignment 14bp with 100.00% identity), Description: hypothetical protein, Location: 478626..480647 (+) In Candida glabrata CBS 138 Chromosome E, ProteinID: 50286947;50295401 ,Accessions: NC_006028 AAGGACTGGGTTGAATACTGCAAGCATTGTCCATATTTGTTCATTCCATACGTTTTCTAG
17 GT_CglaCBS138_Specific_04735 GT_CglaCBS138_Specific_04735 FALSE CAGL0M01056g CAGL0M01056g CAGL0M01056g CAGL0M01056g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 117010..117579 (+) In Candida glabrata CBS 138 Chromosome M, ProteinID: 50295409;50293957 ,Accessions: NC_006036 ; :: Next best hit, CAGL0K11968g(alignment 13bp with 100.00% identity), Description: hypothetical protein, Location: 1153196..1154683 (-) In Candida glabrata CBS 138 Chromosome K, ProteinID: 50292605;50295407 ,Accessions: NC_006034 ATCCCTTTGATGAGCGTAGGTGGCCATGCCTACGTTATAGAAAAGTTACCAGACGTCTTT
18 GT_CglaCBS138_Specific_02768 GT_CglaCBS138_Specific_02768 FALSE CAGL0I03982g CAGL0I03982g CAGL0I03982g CAGL0I03982g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 351158..351433 (+) In Candida glabrata CBS 138 Chromosome I, ProteinID: 50289981;50295405 ,Accessions: NC_006032 ; :: Next best hit, CAGL0K06831g(alignment 14bp with 100.00% identity), Description: hypothetical protein, Location: 665672..666748 (-) In Candida glabrata CBS 138 Chromosome K, ProteinID: 50292175;50295407 ,Accessions: NC_006034 TTACGTGTTGCTGCACAAAACCAGTACATCACAATGCGGGATGTGAATGCAATGCCTTGA
19 GT_CglaCBS138_Specific_01173 GT_CglaCBS138_Specific_01173 FALSE CAGL0E02761g CAGL0E02761g CAGL0E02761g CAGL0E02761g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 260356..260958 (+) In Candida glabrata CBS 138 Chromosome E, ProteinID: 50286759;50295401 ,Accessions: NC_006028 ; :: Next best hit, CAGL0H06545g(alignment 18bp with 100.00% identity), Description: hypothetical protein, Location: 643447..644925 (+) In Candida glabrata CBS 138 Chromosome H, ProteinID: 50295404;50289299 ,Accessions: NC_006031 ATCACAAGCACAAGGACAAGGAATAGCACAACCAATGCAGGACAAAATACCACCTGTGCA
20 GT_CglaCBS138_Specific_01228 GT_CglaCBS138_Specific_01228 FALSE CAGL0E04070g CAGL0E04070g CAGL0E04070g CAGL0E04070g(alignment 60bp with 100.00% identity), Description: hypothetical protein, Location: 389195..390952 (-) In Candida glabrata CBS 138 Chromosome E, ProteinID: 50295401;50286869 ,Accessions: NC_006028 ; :: Next best hit, CAGL0A01628g(alignment 14bp with 100.00% identity), Description: hypothetical protein, Location: 156635..157909 (+) In Candida glabrata CBS 138 Chromosome A, ProteinID: 50295397;50284817 ,Accessions: NC_005967 GTATGGGTCAGAGACTCGAATTCTGAACCTCTCTTTATACAGAAATTAACCTTCCAGTAA

Total number of rows: 15744

Table truncated, full table size 9143 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap