NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL11023 Query DataSets for GPL11023
Status Public on Nov 04, 2010
Title Agilent_Dm_5.1_1M_tiling
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Drosophila melanogaster
Manufacturer Agilent Technologies
Manufacture protocol Agilent Technologies
Catalog number AMADID# 25240481
Support glass
Coating unknown
 
Description high resolution tiling array for modENCODE. Average probe spacing of 117 bp for Drosophila genome (5.1) and unique heterochromatin scaffolds.
 
Web link http://www.modencode.org
Contributor(s) MacAlpine DM, Nordman J, Prinz J
Submission date Oct 07, 2010
Last update date Mar 25, 2011
Contact name David M MacAlpine
E-mail(s) david.macalpine@duke.edu
Phone 919 681 6077
Organization name Duke University Medical Center
Department Pharmacology and Cancer Biology
Street address Box 3813 DUMC
City Durham
State/province NC
ZIP/Postal code 27714
Country USA
 
Samples (6) GSM697657, GSM697659, GSM730652, GSM790608, GSM790610, GSM790724
Series (9)
GSE28178 Fat Body - CGH Differential Replication
GSE28179 Midgut - CGH Differential Replication
GSE29517 ChIP-chip from Drosophila egg chambers using ORC2 antibody

Data table header descriptions
ID
FEATURE Unique local identifier for probe sequence
CHROMOSOME Chromosome
RANGE_GB
SPOT_ID
RANGE_START Genomic coordinate for start of probe sequence
RANGE_END Genomic coordinate for end of probe sequence (+1 nt)
SEQUENCE Oligo sequence
GENOME_SOURCE Genome source from which probes were designed

Data table
ID FEATURE CHROMOSOME RANGE_GB SPOT_ID RANGE_START RANGE_END SEQUENCE GENOME_SOURCE
1 DarkCorner control agilent_control
2 DarkCorner control agilent_control
3 DarkCorner control agilent_control
4 DM_DMEL_05967650 chr3L AE014296.4 11860821 11860870 ACTCAGCTAGATAAATCAACTGGCATTAGAACGGGGTTATGCTGCTGTTG flybase|dmel5.1
5 DM_DMEL_00671890 chr2L AE014134.5 6718891 6718935 GATTGAAGCACATCTACGACGACAGCGATTTCTACCACCAGCAGC flybase|dmel5.1
6 DM_DMEL_09390269 chr3R AE014297.2 18988071 18988120 CGAGCGATAAAGAGACGGCATATTTGTGTTTTGGTTATTCGATCAGTTTG flybase|dmel5.1
7 DM_DMEL_06349280 chr3L AE014296.4 15677121 15677177 TAATGGCCATCGGCAGTATTATCTACTATCTATATACCCTGAAATTGGAGGGGGAGC flybase|dmel5.1
8 DM_DMEL_08101092 chr3R AE014297.2 6096301 6096360 GGAAAGTAGCATATATCACAAACTAAATCCAATTTATATACATATCCTATAACTACTGCA flybase|dmel5.1
9 DM_DMEL_05167623 chr3L AE014296.4 3860551 3860610 ACATGAAATCCTTACGAGCCGCCAACACAGTACTTACAATTTCTTCTGTTTTCTTCTACT flybase|dmel5.1
10 DM_DMEL_02871772 chr2R AE013599.4 5337401 5337445 TCGCCACCAAATGGCAACAGTCTTGCCACCTCAAGTATTCTAAGC flybase|dmel5.1
11 DM_DMEL_01922672 chr2L AE014134.5 19226711 19226763 ATAATTTTCCTGTCGCATTCAATATGAGATGCTCGCAACAAAAAACAAACAAC flybase|dmel5.1
12 DM_DMEL_12638892 chrX AE014298.4 9651071 9651117 ATGAAAAGCCCTGGCTGCTCACTTAAAGCCATCAAGAATTAATGTCG flybase|dmel5.1
13 DM_DMEL_12354579 chrX AE014298.4 6807941 6807995 GCTTCAAGTCTGCATAATCTGCATTGCCTAACTTGTGAATAGTTTTTCTCAGTGC flybase|dmel5.1
14 DM_DMEL_00232753 chr2L AE014134.5 2327521 2327567 CTACAATTGTACGTGTCCGGAAGGATTTTCTGGTAAGTGTGCCCAAG flybase|dmel5.1
15 DM_DMEL_00686140 chr2L AE014134.5 6861391 6861435 TGCCTTGGCCATCCACGACAGTCCCACAAAGAACTTCTCCTTGGT flybase|dmel5.1
16 DM_DMEL_05495696 chr3L AE014296.4 7141281 7141330 CACCGACCTTTTTCCGAAATGCAAAAATAGGATTTGCGAATACAATTCAT flybase|dmel5.1
17 DM_DMEL_02620711 chr2R AE013599.4 2826791 2826835 AACAAGTGTGCAGTTTTCCGGCCTTAGCCACAAAATCCTCCCACA flybase|dmel5.1
18 DM_DMEL_08572142 chr3R AE014297.2 10806801 10806854 CAATCAACAAAATGCGGCATAAAAGGCCAAACTTTAGTTCATACAAATACGAGC flybase|dmel5.1
19 DM_DMEL_07892637 chr3R AE014297.2 4011751 4011795 CGTAAATGAAATCAGTTGGTGCGCGAATCCTGCATGGGTCAATTA flybase|dmel5.1
20 DM_DMEL_02095289 chr2L AE014134.5 20952881 20952940 AAGAATAATTATTTGCTGTAATATCAGATGTTCTAAATTGTAGCAACTAATTATATGCGA flybase|dmel5.1

Total number of rows: 953353

Table truncated, full table size 117906 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL11023_252404810019_pseudo_ndf.txt.gz 29.8 Mb (ftp)(http) TXT
GPL11023_pseudo_pos.txt.gz 7.9 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap