NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL11047 Query DataSets for GPL11047
Status Public on Dec 31, 2010
Title Custom CGH array tiling selected regions on MM6 [2007-04-16_MM6_GK_CGH]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer NimbleGen
Manufacture protocol NimbleGen
 
Description tiling of various regions on mm6, tiled every 10bp, selecting win50, int300 , max 5, mean 350bp, median 351
native array description file: 2007-04-16_MM6_GK_CGH.ndf
native array description file: 2007-04-16_MM6_GK_CGH.pos
 
Submission date Oct 12, 2010
Last update date Jul 15, 2011
Contact name Charlotte N. Henrichsen
Organization name University of Lausanne
Department Center for Integrative Genomics
Street address Quartier Sorge
City Lausanne
ZIP/Postal code CH-1015
Country Switzerland
 
Samples (17) GSM607642, GSM607643, GSM607644, GSM607645, GSM607646, GSM607647 
Series (2)
GSE24640 Validation of a subset of copy number variants from GSE24424 by aCGH
GSE24643 Validation and copy number variation in inbred and wild mice

Data table header descriptions
ID
CHROMOSOME Chromosomal location
RANGE_GB NCBI Build 34 chromosome accession version
RANGE_START Chromosomal start position of oligo
RANGE_END Oligo length
SEQUENCE Sequence of oligo

Data table
ID CHROMOSOME RANGE_GB RANGE_START RANGE_END SEQUENCE
CHR01FS007660585 chr1 NC_000067.2 7660585 7660645 AACTAGTTGTCCCAATATATGAATGGATCCAAAATTATGCCTCGTTGATCCAGACTGGATA
CHR01FS007660955 chr1 NC_000067.2 7660955 7661019 AAAACTGGCACAGCAATCACAAAGATCACATTTCAAGATATCTGAGATAGCTGTTAATGCTGAAG
CHR01FS007661335 chr1 NC_000067.2 7661335 7661391 ATGAAGACAAAATTGAGTTTATGTTTGCCTCTAAATGCAAAACAGGTTTTTGTCATG
CHR01FS007661645 chr1 NC_000067.2 7661645 7661694 ACTGTGGCCTCAGCTAGCATTGTGGCTTCTTCATAAGTAAGTACAGCAAC
CHR01FS007662025 chr1 NC_000067.2 7662025 7662074 TGAACACCCTGAACTCCCTGGGTTATGTGGTTATTGTGATAGAAAACAGG
CHR01FS007662345 chr1 NC_000067.2 7662345 7662394 GAATGAACAGGGCTATTACTTAGGATCTGTGGCCATGCAAGTGGAGAAGT
CHR01FS007662705 chr1 NC_000067.2 7662705 7662765 GAGAAGCTAAAGTTGATGATCCTACTTTGTACCTGCCACATAAGATCTACTCCTGAAAGTA
CHR01FS007663035 chr1 NC_000067.2 7663035 7663097 CTGACTAGTTATGGATTTGATAGCACTAATGTCTAATTGAATAGCTTATGTTTCATCACTTGG
CHR01FS007663435 chr1 NC_000067.2 7663435 7663490 ACAGAACATTTACACATTTACTTGTATTCTGAAAACATAATGGTTCTGTTCCATTT
CHR01FS007664126 chr1 NC_000067.2 7664126 7664185 TAACTTAAAAATCAAACCAAGAAATGTCACTGTGCTTCTTTCTCACTGCCACATCAGGTC
CHR01FS007664476 chr1 NC_000067.2 7664476 7664533 AGTCACAGACAATTTAAACTTAGCAGTGTAGGAATAATGAATAGTTGATACCTGTTTA
CHR01FS007664816 chr1 NC_000067.2 7664816 7664877 TCAATAATATGTAAGGTGCTAAACTTAATTGCCACTGTATGAGATTAATTACAGTCACACAA
CHR01FS007665141 chr1 NC_000067.2 7665141 7665197 AGAAACATGAGTTGATAATGTAGTACCAATAAAAGTAGGTGCCAGGAAAGACAAGAA
CHR01FS007665531 chr1 NC_000067.2 7665531 7665581 CATCCCTCTTGGTGTTACTATCAATATGTTCCTGGGTTTCCATTGGGTTGT
CHR01FS007665871 chr1 NC_000067.2 7665871 7665929 TCAGTAGATATCTGTTTGGTCCATTTTATATTCGAAGTAATTTAGTTCTGAAGCTTCTC
CHR01FS007666189 chr1 NC_000067.2 7666189 7666242 TTTTGTTAACTATTAAGATAGTACTTGTTTGCTTCCTGTTCCCATTTACTTGGA
CHR01FS007666932 chr1 NC_000067.2 7666932 7666989 ACAAAACAAGATTCAATATGACAAGGCAAAAGCCCTCACAAAAGCCCTCATATCAAGG
CHR01FS007667282 chr1 NC_000067.2 7667282 7667331 CCTGAGCTCCGAAGGGAGGGCTCGAATGGAGACCTATAATTTAGACTCTC
CHR01FS007667592 chr1 NC_000067.2 7667592 7667651 TTGATTTTGTTCCTAAATCCATTCAGCTAATTGTCTTGACTTGAGAGTTGAGGTCATTAA
CHR01FS007668312 chr1 NC_000067.2 7668312 7668363 CCTGTATCAATATGAGCAGGTCTTCCCTTCAGGAAGAGAACTTTTCCTTGAT

Total number of rows: 384846

Table truncated, full table size 40562 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL11047_2007-04-16_MM6_GK_CGH.ndf.gz 24.6 Mb (ftp)(http) NDF
GPL11047_2007-04-16_MM6_GK_CGH.pos.gz 3.1 Mb (ftp)(http) POS

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap