NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL11669 Query DataSets for GPL11669
Status Public on Jun 15, 2011
Title NanoString nCounter miRNA expression platform (Validation 2)
Technology type other
Distribution custom-commercial
Organism Homo sapiens
Manufacturer NanoString
Manufacture protocol See manufacturer's website
 
 
Submission date Jan 27, 2011
Last update date Jan 04, 2012
Contact name Muneesh Tewari
E-mail(s) mtewari@fhcrc.org
Organization name Fred Hutchinson Cancer Research Center
Department Human Biology
Lab Tewari
Street address 1100 Fairview Ave, N
City Seattle
State/province WA
ZIP/Postal code 98109
Country USA
 
Samples (2) GSM662868, GSM662869
Series (2)
GSE26919 Post-transcriptional generation of miRNA variants by multiple nucleotidyl transferases contributes to miRNA transcriptome complexity (Validation 2)
GSE26970 Post-transcriptional generation of miRNA variants by multiple nucleotidyl transferases contributes to miRNA transcriptome complexity

Data table header descriptions
ID
miRNA_ID
Target
Bridge Pool
SEQUENCE

Data table
ID miRNA_ID Target Bridge Pool SEQUENCE
1 hsa-miR-200a miRNA Canonical UAACACUGUCUGGUAACGAUGU
2 hsa-let-7b miRNA Canonical UGAGGUAGUAGGUUGUGUGGUU
3 hsa-miR-200b miRNA Canonical UAAUACUGCCUGGUAAUGAUGA
4 hsa-miR-100 miRNA Canonical AACCCGUAGAUCCGAACUUGUG
5 hsa-let-7d miRNA Canonical AGAGGUAGUAGGUUGCAUAGUU
6 hsa-let-7c miRNA Canonical UGAGGUAGUAGGUUGUAUGGUU
7 hsa-let-7a miRNA Canonical UGAGGUAGUAGGUUGUAUAGUU
8 hsa-miR-31 miRNA Canonical AGGCAAGAUGCUGGCAUAGCU
9 hsa-let-7g miRNA Canonical UGAGGUAGUAGUUUGUACAGUU
10 hsa-miR-15a miRNA Canonical UAGCAGCACAUAAUGGUUUGUG
11 hsa-let-7e miRNA Canonical UGAGGUAGGAGGUUGUAUAGUU
12 hsa-let-7i miRNA Canonical UGAGGUAGUAGUUUGUGCUGUU
13 hsa-miR-1246 miRNA Canonical AAUGGAUUUUUGGAGCAGG
14 hsa-miR-106b miRNA Canonical UAAAGUGCUGACAGUGCAGAU
15 hsa-miR-200a miRNA Variant 1 UAACACUGUCUGGUAACGAUGUU
16 hsa-let-7b miRNA Variant 1 UGAGGUAGUAGGUUGUGUGGUUA
17 hsa-miR-200b miRNA Variant 1 UAAUACUGCCUGGUAAUGAUGAA
18 hsa-miR-100 miRNA Variant 1 AACCCGUAGAUCCGAACUUGUGA
19 hsa-let-7d miRNA Variant 1 AGAGGUAGUAGGUUGCAUAGUUA
20 hsa-let-7c miRNA Variant 1 UGAGGUAGUAGGUUGUAUGGUUA

Total number of rows: 42

Table truncated, full table size 2 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap