NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL14015 Query DataSets for GPL14015
Status Public on Aug 12, 2011
Title Histoplasma_capsulatum_G217B_WGTA_026217
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Histoplasma capsulatum
Manufacturer CombiMatrix Corporation (Mukilteo, WA)
Manufacture protocol Arrays were designed based on the Washington University Genome Sequencing Center (GSC) Histoplasma capsulatum strain G217B genome assembly as of 11/30/2004. Degenerate sequence and transposable elements were removed from the assembly using RepeatMasker with default parameters and the repeat families determined by the GSC. The remaining sequence was tiled with 50mer probes at an average frequency of one probe every 60 base pairs. Probe spacing was adjusted to minimize variation in melting temperature, and a subset of probes were truncated to optimize synthesis, in collaboration with CombiMatrix. The number of arrays used to tile a given contig was minimized, and the location of tiling probes was randomized within a given array. In addition, each array contained a common set of control probes, viz.: quality control (QC) and negative control (NC) probes designed by CombiMatrix; positive control probes tiling the genomic loci and non-genic flanking sequence of TEF1(P40911), TYR1, and CBP1(AF006209); and probes specific to a spike-in control sequence. Arrays were synthesized by CombiMatrix.
 
 
Contributor(s) Foo CK, Sil A
Submission date Aug 02, 2011
Last update date Aug 12, 2011
Contact name Mark Voorhies
E-mail(s) mark.voorhies@ucsf.edu
Organization name University of California
Department Microbiology and Immunology
Lab Anita Sil
Street address 513 Parnassus, S472
City San Francisco
State/province CA
ZIP/Postal code 94143-0414
Country USA
 
Samples (1) GSM771264
Series (1)
GSE31155 Experimental annotation of Histoplasma capsulatum transcribed regions using high-resolution tiling arrays

Data table header descriptions
ID
COMBI_ID CombiMatrix probe ID
SPOT_ID
SEQUENCE
RANGE_GB
RANGE_START
RANGE_END
RANGE_STRAND
ROW Row position on array from CombiMatrix GAL file.
COL Column position on array from CombiMatrix GAL file.

Data table
ID COMBI_ID SPOT_ID SEQUENCE RANGE_GB RANGE_START RANGE_END RANGE_STRAND ROW COL
1 76df025a70d0748672dcaf7c924bd1fd_76df025a70d0748672dcaf7c924bd1fd QC-3prime TGACTGACTGGACTGTGGGTGTGCGATACGTGTCC 1 1
2 897052f32640e2baa47cc6764a38caa5_897052f32640e2baa47cc6764a38caa5 QC-5prime TGGGTGTGCGATACGTGTCCGACTGACTGACTGAC 1 2
3 3dc847a24a3bbc545aa51fcedd968fcb HISTO_ZZ.Contig127f|sl-1098523-1098564| CAACAGACGGGGCAAGTTCCACCCGGTCAGTCCGAACCTCCT ABBT01000237.1 1098523 1098564 + 1 3
4 d5152984f1317adfdef6575c0e8f9306 HISTO_ZZ.Contig127f|sl-916886-916928|AS GTCAAATATGACGAACTGCACACTGTGGTGGAGGAAGCCGAGT ABBT01000237.1 916886 916928 - 1 4
5 1d707a27236ca0945311d03309deb0bb HISTO_ZZ.Contig127f|sl-956517-956566|AS GCCGGTTATCTCACACGCAAAATAAATTCGTCTTGACTCCAACACAGAGC ABBT01000237.1 956517 956566 - 1 5
6 8d768341a173b3364ba6c276da9d4978 HISTO_ZZ.Contig127f|sl-1042565-1042614| TGCATTGTTGCTAACAAATGTTATGTAATCTTATAGGAAAGGTCTCACGC ABBT01000237.1 1042565 1042614 + 1 6
7 97eb02abd74b4cbefc86bab68879ddf6 HISTO_ZZ.Contig127f|sl-804634-804675| GAGCAACGGCTACGTCATTCGACTGGCAGAGTGACTAAGCAG ABBT01000237.1 804634 804675 + 1 7
8 f24862da8b870276827f8271d496b765 HISTO_ZZ.Contig127f|sl-1018051-1018092| CATGGTATAAGCTACTGCAGTCGCCAGATTGACGATGCGCCT ABBT01000237.1 1018051 1018092 + 1 8
9 e2db9fc12c717a27262d587ddadc3a1b HISTO_ZZ.Contig127f|sl-1068083-1068124|AS GATGCGTTGTGCGCGCTCCTGATTCGTCTCCGATGACCGTCG ABBT01000237.1 1068083 1068124 - 1 9
10 ec3026781eea6193ebceffb879545146 50mer_control_AS CAAACAACCTTCCGGAGCACTCTTTGATGTTAGGTGATTGGCAAGAAGTT 1 10
11 26af8af642ff71f6bc4390104416417b HISTO_ZZ.Contig127f|sl-856033-856074| GGGACTCTCTTTACCAAGGTCGACCCAGCAATTGACGGGGAA ABBT01000237.1 856033 856074 + 1 11
12 8b8f77606f8e97382d9b48c2b3768f64 HISTO_ZZ.Contig127f|sl-1037159-1037201| CTGCATTTAGAGCGGCAAGTTTTACGTCTATGCTTGCGACGCG ABBT01000237.1 1037159 1037201 + 1 12
13 5d8d87384ad37edc424485dc50c3ee0c HISTO_ZL.Contig1161c:170452,173949 TYR1|sl-3096-3140| CAGATATGCGCTGGACAAGAGGTTACAGATTGTTGGCTGCAGAGG ABBT01000205.1 979521 979565 + 1 13
14 2f211ad3a940913337364f01971cc186 HISTO_ZZ.Contig127f|sl-1030721-1030769| TGAATGGCATAAGATGCAAAGCTAGCTTCGATCCTTAACTTTGTCACAA ABBT01000237.1 1030721 1030769 + 1 14
15 626908e6e986bd3aa6dfc53645d952ce HISTO_ZZ.Contig127f|sl-1008874-1008915|AS AAACTTGCTTGCCCCCAGTTCTTATCCGCAAAACCACTACGC ABBT01000237.1 1008874 1008915 - 1 15
16 78ef257709f3799f255cc57bf0d9b755 HISTO_ZZ.Contig127f|sl-1096759-1096802| ACTCTTTGCCTCCTCCCGACAGTACCGGGAGTTTAGATATCAGC ABBT01000237.1 1096759 1096802 + 1 16
17 a0d94a4378ea3d5bb9abb56600af1876 HISTO_ZZ.Contig127f|sl-1031278-1031320|AS GAACAACAAGGCATTTCCTTCCAGACCTGCAAAACACCCACCA ABBT01000237.1 1031278 1031320 - 1 17
18 986568dcc101b394dbd69e5f953d1316 HISTO_ZZ.Contig127f|sl-862146-862187| TTTGGTTGGCAACGTGCGAGCATACCCGCCCCATCATGTAGC ABBT01000237.1 862146 862187 + 1 18
19 d2c4cab222f3e693661b855f0339f539 HISTO_ZZ.Contig127f|sl-1076601-1076650|AS GCGCGAGTGTAACGCCTTGGTATACCAGAAACTGATACCAAGACTCTTTT ABBT01000237.1 1076601 1076650 - 1 19
20 61084671176caf2ca7007f0ea293658e 50mer_control_mm47_AS CAATGTTGGAAGGCCTCGTGAGAAACTACAATCCACTAACCGTTCTTCAA 1 20

Total number of rows: 12396

Table truncated, full table size 1955 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap