GEO Accession viewer

GSE32195	Analysis of impact of a novel RNA gene named Papillary Thyroid Carcinoma Susceptibility 3 (PTCSC3) on gene expression in papillary thyroid carcinoma cell line cells (TPC-1)
GSE32565	Molecular crosstalk between hepatocytes and hepatic stellate cells.
GSE33447	Gene expression profiles in breast cancer: breast cancer tissues vs. normal breast tissues
GSE33450	DNA hypermethylation and gene expression in breast cancer: breast cancer tissues vs. normal breast tissues
GSE33911	Augmented hematopoiesis in induced pluripotent stem cells derived from patients with Down syndrome.
GSE34143	Gene expression of Epstein-Barr Virus (EBV) positive nodal peripheral T cell lymphoma, unspecified (PTCL-U)
GSE35034	Gene expression of human skin fibroblast cells derived from hypospadias patients in response to low-dose bisphenol A exposure
GSE35792	Gene expression profiles of depletion of Daxx and HOTAIR
GSE36131	Breast cancer cell lines treated with EZH2 inhibitor compounds
GSE36390	Comparison of expression microarray data and somatic mutation signature in primary HCC
GSE36586	Interplay between AP-1 and ERalpha in regulating gene expression and proliferation networks in breast cancer cells
GSE36622	EGI-1 cell line treated with Saracatinib vs EGI-1 cell line untreated; EGI-1 xenograft treated with Saracatinib vs EGI-1 untreated
GSE37100	Transcriptome changes affecting hedgehog and cytokine signalling in the umbilical cord in late pregnancy: implications for disease risk
GSE37223	Global gene expresion profile of phenotypically distinct human mammary epithelial subpopulations of various developmental age
GSE37660	Transcription profile of adipose-resident macrophages and mesenchymal stem cells.
GSE37753	AGS cells infected with Epstein Barr Virus
GSE38050	Genomic and phenotypic alterations of the neuronal-like cells derived from the human embryonal carcinoma stem cells (NT2) caused by exposure to the organophosphorus compounds paraoxon and mipafox
GSE38054	Therapeutic effect of γ-secretase inhibition in KrasG12V-driven non-small cell lung carcinoma through derepression of DUSP1 phosphatase and inhibition of ERK
GSE38152	sibling aHDF-iPSC clones derived from the same fibroblasts
GSE38153	aHDF- and PB-iPSC clones from the same individuals
GSE38155	Donor-dependent hepatic differentiation propensity among hiPSC lines.
GSE38947	Comparative gene expression profile of human limbal stromal cells, bone marrow mesenchymal cells, adipose cells and foreskin fibroblasts
GSE39021	Gene expressions in normal breast duct vs lobule
GSE39489	Analysis of neonatal B lymphocytes
GSE39606	Gene expression data in CD4+ and CD8+ cells in sarcoidosis patients following antimycobacterial therapy
GSE39628	Effects of DNA methyltransferase inhibitors (DNMTIs) on MDS-derived cell lines
GSE39723	HSC-3 cells (control) vs. HSC-3-5 cells [cell line]
GSE39725	HSC-3 cells (control) vs. HSC-3-5 cells [tongue]
GSE39726	HSC-3 cells (control) vs. HSC-3-5 cells [subcutaneous tumor]
GSE39729	HSC-3 cells (control) vs. HSC-3-5 cells
GSE39773	The effect on gene expression by the knockdown of lincRNAs
GSE40033	The gene expression pattern of bone marrow mesenchymal stem cells from patients with psoriasis
GSE41023	Transcriptional profiling of hypoxic cells and identification of HEXIM1-dependent genes.
GSE41192	High fidelity patient-derived xenografts for accelerating prostate cancer discovery and drug development (expression)
GSE41193	High fidelity patient-derived xenografts for accelerating prostate cancer discovery and drug development
GSE41375	Gene expression profiling of chronic myeloid leukemia with variant t(9;22) reveals a different signature from cases with classic translocation.
GSE41477	Mutant p53 attenuates the anti-tumorigenic activity of fibroblasts secreted interferon (IFN) beta
GSE41573	Gene expression data in Meg-01 cells following transfection with platelet-enriched microRNA-1225-3p
GSE41575	Role of platelet micrornas in sickle cell disease
GSE41681	Influence of plasma from normal and preeclamptic women on HUVEC cells
GSE41767	Chlorella ingestion and suppression of resistin gene expression in borderline diabetics: a randomized, placebo-controlled study
GSE41919	Gene expression profiling in the cerebral cortex of patients with cirrhosis with and without hepatic encephalopathy
GSE42318	Expression data from Disulfiram or 5-FU treated tumor-initiating hepatocellular carcinoma (HCC) cells.
GSE42405	Gene expression profiling of FUT8 knockdown CL1-5 cells
GSE42445	Comparison of gene expression profilings between hESCs and hiPSCs
GSE42452	Comparison of gene expression profilings between SFEBq differentiation-defective clones and good clones
GSE42620	Human ALL Cell line RS4;11: Control vs. VE-465 treated
GSE43005	Profiling of human CD4+ T subsets identifies a Th2-specific non-coding RNA GATA3-AS1
GSE43029	RNASET2-silenced and control OVCAR3 cell clones injected into nude mice.
GSE43136	Global gene expression analysis of peripheral blood cells, pluripotent cell lines, and iPS-derived T cells
GSE43166	Folate and vitamin B12 imbalance induces endoplasmic reticulum stress and cholesterol biosynthesis gene expression in human adipocytes
GSE43328	Gene-expression comparison of human iPS cells
GSE43402	Gene expression profile of TCR Vdelta1 positive gammadelta T cells expressed CD161
GSE43455	Monitoring response and resistance to the novel arsenical darinaparsin in an AML patient
GSE44044	Xi-reactivation in female human induced pluripotent stem cells (hiPSCs)
GSE44066	Analyses of X-inactivation status in female human induced pluripotent stem cells
GSE44115	Angiosarcoma gene expression
GSE44447	BAI3, CDX2 and VIL1: a panel of three antibodies to distinguish small cell from large cell neuroendocrine lung carcinomas
GSE44666	Interplay of choline metabolites and genes in patient-derived breast cancer xenografts
GSE44716	Comparative study of deoxynivalenol and 15-acetyldeoxynivalenol on gene expression in the human cell line Caco-2
GSE44952	Upstream regulators of human T cell-associated diseases (dataset 1)
GSE44956	Integrated genomic and prospective clinical studies show the importance of modular pleiotropy for disease susceptibility, diagnosis and treatment (dataset 1)
GSE44964	Integrated genomic and prospective clinical studies show the importance of modular pleiotropy for disease susceptibility, diagnosis and treatment (dataset 2)
GSE44966	Integrated genomic and prospective clinical studies show the importance of modular pleiotropy for disease susceptibility, diagnosis and treatment
GSE45001	Gene expression profiling of tumor stroma in human intrahepatic cholangiocarcinoma
GSE45184	linc-UBC1 physically associates with polycomb repressive complex 2 (PRC2) and acts as a negative prognostic factor for lymph node metastasis and survival in bladder cancer
GSE45397	NcRNA profiling after Influenza A/WSN/33 infection I
GSE45399	Evidence for a Crucial Role of a Host Non-coding RNA in Influenza A Virus Replication
GSE45783	Identification of a novel, recurrent MBTD1-CXorf67 fusion in low-grade endometrial stromal sarcoma (expression)
GSE46059	Development of gene expression signatures for miR-218 overexpression
GSE46238	Sputum cell gene expression following allergen challenge
GSE46271	PINT lincRNA connects the p53 pathway with epigenetic silencing by the Polycomb Repressive Complex 2 (tissue)
GSE46272	PINT lincRNA connects the p53 pathway with epigenetic silencing by the Polycomb Repressive Complex 2
GSE46285	Identification of a novel, recurrent MBTD1-CXorf67 fusion in low-grade endometrial stromal sarcoma
GSE46333	A module-based translational strategy shows a central role for S100A4 in allergy
GSE46353	Isolation and Characterization of a Novel Population of Pluripotent Stem Cells Derived from Human Adipose Tissue
GSE46720	Effects of EDAG knockdown on gene expression profiles in human erythroid cells
GSE47096	The effect on gene expression by p53 family members and the knockdown of AKR1B10
GSE47146	Transcriptome Analysis of Cbx7 Knockdown Effects in Ovarian Clear Cell Adenocarcinoma Cell Lines
GSE47187	Analysis of differentially expressed genes in placental tissues of Pre-eclampsia Using microarray combined with Connectivity Map database
GSE47460	Gene expression profiling of chronic lung disease for the Lung Genomics Research Consortium
GSE47489	Maturation,not initiation, is major roadblock during reprogramming toward pluripotency from human fibrobalsts
GSE47584	Gene expression profiling in whole blood in patients for Klinefelter’s Syndrome
GSE48030	Expression of FUS-CHOP fusion protein in immortalized/transformed human Mesenchymal Stem Cells drives mixoid liposarcoma formation
GSE48047	Gene expression profile of duodenal follicular lymphoma
GSE48523	Gene expression signatures of C-terminal shorter RUNX1 protein hematopoietic models
GSE49053	Differentiation defective phenotypes revealed by large scale analyses of human pluripotent stem cells
GSE49301	Human hepatic stellate cell line LX-2 activated under acidic culture condition
GSE49342	GATA2 as a potential prostate cancer metastasis-driving gene
GSE49369	TIGIT+ iTregs elicited by human regulatory macrophages control T cell immunity
GSE49567	Gene expression profile of ATF6a and ATF6b overexpression in LS174T cells
GSE50061	Gene expression in human breast cancer cell lines regulated by HIC1 gene
GSE50206	Induction of pluripotency in human somatic cells via a primitive streak-like state
GSE50579	Expression profiling of HCC
GSE51030	Gene expression analysis of human adipose-derived stem cells.
GSE51051	The effect of MEK inhibition on transcription in melanoma [Batch 1]
GSE51113	The effect of MEK inhibition on transcription in melanoma [Batch 2]
GSE51114	The effect of MEK inhibition, Interferon beta, and their combination on transcription in melanoma
GSE51115	The effect of MEK inhibition on transcription in melanoma
GSE51171	Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells [AFB1]
GSE51172	Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells [BaP]
GSE51173	Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells [BaP 8hr]
GSE51174	Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells [DEX]
GSE51175	Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells
GSE51259	CD271 on melanoma cell is an IFN-γ-inducible immunosuppressive factor that mediates downregulation of melanoma antigens
GSE51460	Long-term androgen withdrawal and treatment (R1881) of LNCaP-FGC prostate cancer cells
GSE51461	REST knockdown in LNCaP prostate cancer cells
GSE51463	LNCaP
GSE51757	Genome-wide profiling of DNA methylation and expression identifies CIMP in myelodysplastic syndrome [Agilent]
GSE51759	Genome-wide profiling of DNA methylation and expression identifies CIMP in myelodysplastic syndrome
GSE51791	Generation of functional cholangiocytes from human pluripotent stem cells and HepaRG cells
GSE51995	Gene expression profiling of paired pterygium and conjunctiva tissues
GSE52052	Comparison of gene expression at day 11 of iPSC reprogramming with different reprogramming cocktails
GSE52065	Gene expression analysis upon stable SmcHD1 Knock Down
GSE53351	Large-scale East-Asian eQTL mapping reveals novel candidate genes for LD mapping and the genomic landscape of transcriptional effects of sequence variants
GSE53415	Gene expression profiling of primary human hepatocytes after berberine chloride treatment
GSE53416	MicroRNA and gene expression profiling of primary human hepatocytes after berberine chloride treatment
GSE53756	Gene expression analysis of lymphoblast cells in patients with genetic defects in comparison with normal control samples: Profile and characterization of gene pathway expression
GSE54168	Effect of excessive c-MYC expression on self-replication and apoptosis of iPS cell-derived megakaryocyte progenitor cell lines
GSE54698	Host cell responses to persistent mycoplasmas--different stages in infection of HeLa cells with Mycoplasma hominis
GSE54848	Critical role of transient activation of human endogenous retroviruses during reprogramming toward pluripotency
GSE54956	Expression data from TRIBAL antisense knock-down in Huh7 hepatoma cells
GSE54957	Functional analysis of the TRIB1 associated locus (TRIBAL) linked to plasma triglycerides and coronary artery disease
GSE55118	Inadequate mito-biogenesis in primary dermal fibroblasts from old humans is associated with impairment of PGC1A-independent stimulation.
GSE55206	Physical and functional interactions between the histone H3K4 demethylase JARID1A and the NuRD complex
GSE55349	Understanding toxicity pathways of gold nanoparticles: RNA expression study on Caco-2 human colon carcinoma cells
GSE55526	Transcription profile of SSEA-3-positive population of MSCs
GSE55704	Upstream regulators of human T cell-associated diseases
GSE55761	SILENCING OF PNPLA6, THE NEUROPATHY TARGET ESTERASE (NTE) CODIFYING GENE, ALTERS HUMAN NEURODIFFERENTIATION IN VITRO
GSE55953	Ionizing Radiation Induced Gene Expression Alterations in Human Peripheral Blood Mononuclear Cells
GSE55955	Ionizing Radiation Induced Gene and micro RNA Expression Alterations in Human Peripheral Blood Mononuclear Cells
GSE56085	The effect of bisphenol A on human preadipocyte differentiation.
GSE56156	The effect on gene expression by shRNA-58335
GSE56308	Fibrotic and Immune Pathway Signatures in Systemic Sclerosis Suggest a Progressive, Multi-step Model of Disease Pathogenesis
GSE56322	Analysis of gene expression profile in 5-fluorouracil (5-FU)-resistant human colon cancer cells
GSE57135	Global gene expression analysis reveals importance of thermal effect in cellular response to millimeter wave exposure
GSE57193	Gene expression profiling in post mortem brain samples of patients with cirrhosis with and without hepatic encephalopathy
GSE57225	Intra-individual genome expression analysis reveals a specific molecular signature of psoriasis and eczema
GSE57446	Impact of the 3D Microenvironment of Phenotype, Gene Expression, and EGFR Inhibition of Colorectal Cancer Cell Lines
GSE58121	Clinically non-involved skin of patients with psoriasis, lichen planus, and healthy individuals
GSE58212	Integrated analysis reveals microRNA networks coordinately expressed with key proteins in breast cancer [mRNA]
GSE58215	Integrated analysis reveals microRNA networks coordinately expressed with key proteins in breast cancer
GSE58267	Genomic and functional characterization of human T cell responses to co-stimulation with an agonistic anti-CD27 mAb, 1F5 (Varlilumab)
GSE58422	Proinflammatory effect of Pseudomonas aeruginosa hook protein FlgE on human corneal epithelial cells
GSE58430	Transcriptomic profiling of peripheral blood CD4+ T cells in asthmatics with and without depression
GSE58431	TK6 toxicogenomics reference database
GSE58561	Gene expression profiles for Pancreatic ductal adenocarcinoma cell lines and their corresponding normal and fresh frozen tissues.
GSE58782	Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells
GSE59069	OSCC whole genome expression by T stage
GSE59308	Differentiation of DLBCL induced by HDAC inhibitors is associated with sensitization to proteasome inhibition
GSE59450	Gene expression analysis during adipocytic differentiation of human bone marrow cells (hMSC-TERT)
GSE59458	Gene expression analysis of human bone marrow cells (hMSC-TERT) transfected with mIR-320c or miR-negative control at 72hrs post-transfection
GSE59462	RMECs: hypoxia-induced group vs. paired untreated group
GSE59984	The placental gene PEG10 promotes progression of neuroendocrine prostate cancer [Expression]
GSE59986	The placental gene PEG10 promotes progression of neuroendocrine prostate cancer
GSE60042	Integration of transcriptome and methylome analyses to dissect molecular pathogenesis of primary aldosteronism: comparision between aldosterone-producing adenomas and adjacent adrenal glands [transcriptome]
GSE60044	Integration of transcriptome and methylome analyses to dissect molecular pathogenesis of primary aldosteronism: comparision between aldosterone-producing adenomas and adjacent adrenal glands
GSE60201	Gene expression profiling of noncancerous prostate epithelial cells (RWPE-1) following pre-miR-424 transfection
GSE60329	Gene expression profiling of prostate cancer (PCa) and normal prostatic samples
GSE60371	miR-424 induces COP1 silencing and STAT3 activation in prostate cancer: a novel miRNA-dependent axis driving tumor progression
GSE60432	The Assembly of miRNA-mRNA-protein Regulatory Networks Using High-throughput Expression Data (mRNA)
GSE60433	The Assembly of miRNA-mRNA-protein Regulatory Networks Using High-throughput Expression Data
GSE60484	Gene expression in human breast cancer cell lines regulated by CXCR6 gene
GSE60632	Synthetic mRNA switches for detection and purification of cardiomyocytes and endothelial cells derived from human pluripotent stem cells [mRNA]
GSE60633	Efficient detection and purification of cell populations using synthetic microRNA switches
GSE60634	Enhanced engraftment, proliferation, and therapeutic potential in heart using optimized iPSC-derived cardiomyocytes
GSE60678	A validated gene regulatory network and GWAS identifies early regulators of T-cell associated diseases (Th1 Th2)
GSE60680	A validated gene regulatory network and GWAS identifies early regulators of T-cell associated diseases
GSE60683	LASSIM -a network inference toolbox for genome-wide mechanistic modeling
GSE60809	Reprogramming-associated aberrant DNA methylation determines hematopoietic differentiation capacity of human induced pluripotent stem cells [Undifferentiated human induced pluripotent stem cells]
GSE60810	Reprogramming-associated aberrant DNA methylation determines hematopoietic differentiation capacity of human induced pluripotent stem cells [Human pluripotent stem cells-derived hematopoietic precursor cells]
GSE60922	Reprogramming-associated aberrant DNA methylation determines hematopoietic differentiation capacity of human induced pluripotent stem cells [iPS_derived_erythroiblasts]
GSE60924	Reprogramming-associated aberrant DNA methylation determines hematopoietic differentiation capacity of human induced pluripotent stem cells
GSE60957	A dominant-negative isoform of IKAROS expands primitive normal human hematopoietic cells
GSE60979	mRNA and miRNA expression profiles for fresh frozen periampullary adenocarcinomas (pancreatobiliary and intestinal type) and adjacent normal tissues. [mRNA]
GSE60980	mRNA and miRNA expression profiles for fresh frozen periampullary adenocarcinomas (pancreatobiliary and intestinal type) and adjacent normal tissues.
GSE61009	Gene expression profiling in MCF-7 cells overexpressing distal-less homeobox 2 (Dlx-2)
GSE61214	Identification of DEK as a potential therapeutic target for Neuroendocrine prostate cancer
GSE61615	Gene expression signatures for bladder cancer tissues and normal adjacent tissues
GSE61906	HSP90 empowers evolution of resistance to hormonal therapy in human breast cancer models
GSE61983	A combined omics approach to generate the surface protein atlas of human naive CD4+ T cells during early TCR activaion
GSE62199	Effect of 6 weeks of high fat diet on gene expression in human subcutaneous adipose tissue of twins
GSE62636	Identification of metastasis-related genes and metastasis-related pathway in squamous cell carcinoma
GSE63322	UNC50 prompts G1/S transition and proliferation in HCC through regulation of epidermal growth factor receptor trafficking
GSE63519	Gene expression analysis of Stabilin-1 positive human monocytes
GSE63544	Studying relative gene expression in primary and xenograft CRC samples
GSE63545	Studying relative gene expression in Head and Neck (HNSCC) tumor under diverse culture conditions
GSE64527	Tetraspanin family member, CD82, regulates expression of EZH2 via inactivation of p38 MAPK signaling in leukemia cells. The novel function of CD82 and its impact on BCL2L12 via AKT/STAT5 signal pathway in acute myelogenous leukemia cells.
GSE64812	Analysis of Primary and Expanded NK Cells for Future Clinical Use
GSE65204	The Nasal Gene Expression and Childhood Atopic Asthma
GSE65205	Childhood Atopic Asthma
GSE65240	Effects of dexamethasone for primary trabecular meshwork cell gene expression
GSE65405	Nilotinib (Tasigna) in the Treatment of Early Diffuse Systemic Sclerosis: An Open-Label, Pilot Clinical Trial
GSE65645	LncRNA Expression Discriminates Karyotype and Predicts Survival in B-lymphoblastic Leukemia (Agilent)
GSE65647	LncRNA Expression Discriminates Karyotype and Predicts Survival in B-lymphoblastic Leukemia
GSE65652	Cancer-adipoocyte interaction by co-culture of MCF7 and human primary adipocytes
GSE65801	Characterization of differentially expressed genes involved in pathways associated with gastric cancer
GSE66321	Gene expression changes reflect clinical response in a placebo-controlled randomized trial of abatacept in patients with diffuse cutaneous systemic sclerosis
GSE66413	Genome-Wide Gene Expression Profiles in the Pancreatic Lymph Nodes of At-Risk Autoantibody Positive Individuals
GSE66758	Identification of mir-342-3p functionally associated with transcriptional activity of MYC in lung cancer [cell culture]
GSE66759	Identification of mir-342-3p functionally associated with transcriptional activity of MYC in lung cancer [patients]
GSE66760	Identification of mir-342-3p functionally associated with transcriptional activity of MYC in lung cancer
GSE66850	Therapy-Induced Developmental Reprogramming of Prostate Cancer Cells and Acquired Resistance [Dataset 1]
GSE66852	Therapy-Induced Developmental Reprogramming of Prostate Cancer Cells and Acquired Resistance
GSE66863	Genome-wide DNA methylation signature in lung adenocarcinomas has prognostic impact [gene expression]
GSE67396	A Hightroughput Approach for Screening Potential Green Plasticizers Using A Human Prostate Cell Line [set1]
GSE67397	A Hightroughput Approach for Screening Potential Green Plasticizers Using A Human Prostate Cell Line [set2]
GSE67398	A Hightroughput Approach for Screening Potential Green Plasticizers Using A Human Prostate Cell Line [set3]
GSE67399	A Hightroughput Approach for Screening Potential Green Plasticizers Using A Human Prostate Cell Line
GSE67598	Gene Expression Analysis in NCI-H520 human cancer cells upon deadenylase silencing
GSE67822	Master transcription factors in corneal epithelial cells [in vivo samples]
GSE67823	Master transcription factors in corneal epithelial cells
GSE67846	Identification of a potent and selective chemical probe for exploring the role of Mediator complex-associated protein kinases CDK8 and CDK19 in human disease [LS-174-T]
GSE67849	Identification of a potent and selective chemical probe for exploring the role of Mediator complex-associated protein kinases CDK8 and CDK19 in human disease
GSE68240	Gene expression profiling for human iPS-derived motor neurons from sporadic ALS patients reveals a strong association between mitochondrial functions and neurodegeneration
GSE68425	Gene expressions specifically induced by the presence of SFB
GSE68458	Analysis of NR4A-specific gene expression in human alveolar rhabdomyosarcoma in response to specific gene knockdown
GSE68774	Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells [PB]
GSE68855	Integration of metabolic activation with a predictive toxicogenomics signature to classify genotoxic versus nongenotoxic chemicals in human TK6 cells [S9]
GSE70103	Gene expression analysis of human bone marrow cells (hMSC-TERT) sorted from MCF7 and BT-20 co-culture
GSE70280	Comparison of the Transcriptional Profiles of Melanocytes from Dark and Light Skinned Individuals under Basal Conditions and Following Ultraviolet-B Irradiation
GSE70864	BAL cell gene expression is predictive of Mortality in Idiopathic Pulmonary Fibrosis and enriched for Genes of Airway Basal Cells (I)
GSE70866	BAL cell gene expression is predictive of Mortality in Idiopathic Pulmonary Fibrosis and enriched for Genes of Airway Basal Cells (II)
GSE70867	BAL cell gene expression is predictive of Mortality in Idiopathic Pulmonary Fibrosis and enriched for Genes of Airway Basal Cells
GSE70914	HEK293T cells treated with a G9a small molecule inhibitor (UNC0638) or vehicle (DMSO), WIZ siRNA, G9a siRNA, or scrambled (control) siRNA
GSE71092	Knockdown of STAiR18, an IL-6/STAT3-induced long noncoding RNA, in INA-6 multiple myeloma cells
GSE72342	HT1080 WT or STAT deficient exposed to IFN beta or human trophoblast medium
GSE72492	Gene expression in the pancreas of healthy control, auto-antibody positive, and type 1 diabetic subjects
GSE72503	C646, a Novel p300/CREB-Binding Protein-Specific Inhibitor of Histone Acetyltransferase, Attenuates Influenza A Virus Infection
GSE72611	Cardiac maturation process from human iPSCs
GSE73090	An improved method for the isolation of endometrial epithelial and stromal cells from the total hysterectomy specimen
GSE73629	Reprogramming-associated aberrant DNA methylation determines hematopoietic differentiation capacity of human induced pluripotent stem cells [parental_lines_expression]
GSE74216	Application of the TGx-28.65 toxicogenomics biomarker to classify genotoxic and non-genotoxic chemicals in human TK6 cells in the presence of rat liver S9
GSE74481	Genome-wide screening of mRNA expression in leprosy patients
GSE74662	Genetically engineering self-organization of human pluripotent stem cells into a liver bud-like tissue using Gata6
GSE74701	Engineering of Three Dimensional Micro Nerve Tissue Using Postnatal Stem Cells from Human Dental Apical Papilla
GSE75095	Reprogramming-associated aberrant DNA methylation determines hematopoietic differentiation capacity of human induced pluripotent stem cells [Erythroid_lines]
GSE75096	Reprogramming-associated aberrant DNA methylation determines hematopoietic differentiation capacity of human induced pluripotent stem cells [iPSC_ESC_lines]
GSE75752	Acquisition of stem cell properties in tumor-derived hepatocyte-like cells leads to metabolic reprogramming and chemoresistance
GSE75970	Gene expression profile Colorectal Tumor and Normal tissue samples
GSE76180	Tissue engineered colorectal cancer metastasis
GSE76761	Human AK2 links intracellular bioenergetic redistribution to the fate of hematopoietic progenioptors
GSE76806	Gene expression in limited cutaneous systemic sclerosis skin
GSE76809	Multi-tissue functional genomic study of systemic sclerosis
GSE77199	Development of gene expression profiles for tumour derived endothelium vs. matched healthy tissues (in renal cell carcinoma, colorectal cancer and colorectal metastasis to the liver)
GSE77244	Human Toxome Project, E2 and PPT induction of MCF-7 cells (NC series)
GSE77358	Expression Profiles of MicroRNA, its genes and proteins targets and Stromal Genes in Aggressive Behavior Tumors from Young Patients with Breast Cancer.
GSE77516	BIRC6-targeting as potential therapy for advanced, enzalutamide-resistant prostate cancer
GSE77671	Transcriptional identity and function of human dendritic cells is dictated by origin not tissue microenvironment
GSE78813	Identifying Bit1-regulated genes in the EC9706 cells
GSE79101	Development of gene expression signatures for lung cancer cells interaction with human monocyte-derived macrophages
GSE79251	Master transcription factors in corneal epithelial cells [OVOL2 Knock-down]
GSE79673	Transcriptional profiles of stomach organoids from human embryonic stem cells.
GSE79876	Regulatory Landscape and Clinical Implication of MBD3 in Human Malignant Glioma [low-grade glioma and glioblastoma screening]
GSE79877	Regulatory Landscape and Clinical Implication of MBD3 in Human Malignant Glioma [MBD3 knockdown in SF767]
GSE79878	Regulatory Landscape and Clinical Implication of MBD3 in Human Malignant Glioma
GSE80356	Angiopoietin-like 4 enhances the ability of tendon fibroblasts to undergo proliferation and migration
GSE80999	Integrative clustering reveals a novel split in the luminal A subtype of breast cancer with impact on outcome
GSE81002	Integrative clustering reveals a novel split in the luminal A subtype of breast cancer with impact on outcome
GSE81453	Reprogramming-associated aberrant DNA methylation determines hematopoietic differentiation capacity of human induced pluripotent stem cells [iPSCs_expression_with_different_culture_conditions]
GSE81517	Microarray analysis of xenograft model to characterize the CNS leukemia
GSE81519	Transcriptome analysis of CNS leukemia
GSE81835	Gene expression signatures for TCM Suduxing treated HepG2.2.15 cells compared to Suduxing untreated HepG2.2.15 cells
GSE81915	Gene expression signature of the T-ALL cell line LOUCY treated with 250nM (+)-JQ1 for 4h
GSE81917	Gene expression signature of the T-ALL cell line LOUCY treated with 1µM (+)-JQ1 for 48h
GSE81918	Targeting BET proteins improves the therapeutic efficacy of BCL-2 inhibition in T-cell acute lymphoblastic leukemia
GSE82189	UGT2B17 Expedites Castration-Resistant Prostate Cancer Progression through Promoting Ligand-independent AR Signaling
GSE83591	Gene expression profiles of tumor epithelium and tumor-associated stroma of HER2+ breast tumors, plus normal epithelium and stroma from HER2+ and HER2- breast tumors
GSE83627	Gene expression differences between pterygium and conjunctiva tissues
GSE83633	Gene regulation by EZH2 inhibitors
GSE83829	ADDITIVE EFFECTS OF MILLIMETER WAVES AND 2 DEOXYGLUCOSE CO-EXPOSURE ON THE HUMAN KERATINOCYTE TRANSCRIPTOME
GSE83981	Exosomal microRNA, miR-1246, induces cell motility and invasion through the regulation of DENND2D in oral squamous cell carcinoma
GSE84796	Whole human genome expression analysis on left ventricular free wall heart tissue samples
GSE85116	Experimental identification of apoptosis-associated miR-21 target genes in Jurkat T-cells using a high-throughput experimental approach
GSE85129	Transcriptional profiles of hASCs cultured on RCP
GSE85301	Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early stage lung adenocarcinoma
GSE85371	PHF6 keeps hematopoietic lineage development in check [Jurkat]
GSE85373	PHF6 is a key regulator of normal human hematopoiesis by modulating NOTCH1 signaling activity
GSE85426	Peripheral blood gene expression as a biomarker for early detection of Alzheimer’s disease
GSE86330	Gene expression signatures in activated CD4 T cells to predict_vaccine responses
GSE86332	Gene expression signatures to predict T cell responses to zoster vaccination
GSE86453	Enrichment of pluripotent stem cell-derived hepatocyte-like cells
GSE86463	The IKK complex requires Morgana to drive NF-kB dependent breast cancer metastatisation
GSE87593	Genetic expression of stage IV oral squamous cell carcinoma according to the recurrence
GSE88715	Gene expression profiles of microdissected tumor epithelium and stroma from TN breast tumors
GSE89021	Gene expression in matched samples of peripheral whole blood collected and processed using the PAXgene vs Tempus system
GSE89022	Gene expression in the peripheral whole blood of established Type 1 diabetes patients
GSE89317	Gene expression profile of biochemically recurrent prostate cancer
GSE90122	Analysis of gene expression in human primary hepatocytes (HPPs) in response to the treatment of hPXR antagonist (SPA70) and agonists (rifampicin, SR12813, and TO90137)
GSE90505	Identification of interacting stromal properties in triple-negative breast cancer - Stromal Discovery Set
GSE90721	The morphological and functional differences and similarities of immune cells between non-human primates and humans [human]
GSE90723	The morphological and functional differences and similarities of immune cells between non-human primates and humans
GSE92435	Gene expression analysis following 6h-, 12h-, 18h- and 24h-siRNA knockdown of transforming growth factor β receptor III (TGFBR3) in human pulmonary arterial smooth muscle cells (hPASMC).
GSE92481	Gene expression analysis following 24h- and 48h-siRNA knockdown of transforming growth factor β receptor III (TGFBR3) in human pulmonary arterial smooth muscle cells (hPASMC).
GSE93170	mRNA profile in CD4+ T cell in healthy control and Primay biliary cholangitis (PBC) [mRNA]
GSE93172	microRNA-mRNA integral analysis in CD4+ T cell in primay biliary cholangitis (PBC)
GSE93193	Inhibition of CDK8 Mediator Kinase Suppresses Estrogen Receptor Signaling and Growth of Estrogen Receptor Positive Breast Cancer
GSE94141	Gene expression profiles of RALD iPSCs cultured with or without bFGF
GSE94289	Genes altered by L-asparaginase treatment in REH cells
GSE94811	The ALK downregulated target gene HBP1 and repressor of MYCN activity as synergistic target for combined PI3K/HDAC inhibition [microarray]
GSE94858	Gene expression profiling of HepG2 cells after knockdown of β-catenin
GSE95187	Application of the TGx-28.65 genomic biomarker to assess the genotoxicity of disperse orange and 1,2,4-benzenetriol in human cells [DO]
GSE95192	Application of the TGx-28.65 genomic biomarker to assess the genotoxicity of disperse orange and 1,2,4-benzenetriol in human cells
GSE95193	The ALK downregulated target gene HBP1 and repressor of MYCN activity as synergistic target for combined PI3K/HDAC inhibition
GSE95219	Gene expression profiling of the intact dermal sheath cup of human hair follicle
GSE95508	LASSIM -a network inference toolbox for genome-wide mechanistic modeling [USF2, KLF6/COPEB, CBL and HIS1 siRNA]]
GSE95684	Analysis of Gene Expression in Medulloblastoma
GSE97199	Characterization of human dental pulp cells grown in chemically defined serum-free medium
GSE97248	Belimumab for the Treatment of Early Diffuse Systemic Sclerosis: Results of a Randomized, Placebo Controlled Pilot Trial
GSE98114	Transcriptome analysis of inflammation-related gene expression in endothelial cells activated by complement MASP-1
GSE98525	Gene expression analysis in PKP2mut cardiomyocytes
GSE98770	Gene expression profiling of acute type A aortic dissection combined with in vitro assessment
GSE99422	KH-type splicing regulatory protein (KHSRP) is involved in esophageal squamous cell carcinoma progression through regulating a subset of microRNAs [mRNA]
GSE99424	KH-type splicing regulatory protein (KHSRP) is involved in esophageal squamous cell carcinoma progression through regulating a subset of microRNAs
GSE99470	Nano-structural analysis of engrafted human induced pluripotent stem cell-derived cardiomyocytes in mouse hearts using a genetic-probe APEX2.
GSE100926	Gene expression signatures for bladder cancer tissues and normal adjacent tissues.
GSE101626	Effects of Inhibition of CDK8/19 Mediator Kinase by Senexin A in HEK293 cells treated with TNF-alpha I
GSE101627	Effects of Inhibition of CDK8/19 Mediator Kinase by Senexin A in HEK293 cells treated with TNF-alpha II
GSE101630	Effects of Inhibition of CDK8/19 Mediator Kinase by Senexin B in HCT116 and HEK293 cells treated with or without TNF-alpha
GSE103716	gene profiling changes induced by regulation of Brachyury expression
GSE104438	Transcriptome analysis of human monocyte-derived myeloid cells
GSE106784	Whole genome gene microarray for diffuse gliomas
GSE107789	Gene expression during adipocytic differentiation of human bone marrow stromal stem cells
GSE107800	mRNA profiling of MCF7 cells transfected with a miR-139-5p mimic
GSE111351	Daytime variation of perioperative myocardial injury in cardiac surgery and its prevention by Rev-Erbα antagonism: a single-centre propensity-matched cohort study and a randomised study
GSE111355	Acute HSF1 depletion induces cellular senescence through activation of the MDM2-p53-p21 pathway in human diploid fibroblasts
GSE111544	Whole human genome expression analysis on left ventricular free wall heart tissue samples (Dilated Cardiomyopathy)
GSE111590	Analysis of downstream genes associated with JMJD2A silencing in MKN45 cells.
GSE111776	Development of gene expression signatures for ovarian cancer stem cells
GSE112123	DMSO effect on HepaRG differentiation
GSE117545	Comparison of expression profile between fibroblasts taken from young (23 years old) and aged (70 years old) donors
GSE118556	Identification of malignant phenotype related genes in pancreatic ductal adenocarcinoma
GSE119267	MicroRNA and mRNA regulatory network in EGFR-mutated lung adenocarcinoma [mRNA]
GSE119269	MicroRNA and mRNA regulatory network in EGFR-mutated lung adenocarcinoma
GSE120929	Amino acids availability and subsequent metabolic reprogramming sustain endocrine resistance in breast cancer (mRNA)
GSE120931	Amino acids availability and subsequent metabolic reprogramming sustain endocrine resistance in breast cancer
GSE121828	Transcriptional response of HT-29 intestinal epithelial cells to bovine colostrum fraction and 3'-Siallylactose.
GSE123986	Integrated miRNA and mRNA expression analysis uncovers drug targets in squamous cell carcinoma patients [mRNA]
GSE124490	Dental pulp cell-derived powerful inducer of TNF-alpha comprises PKR containing stress granule rich microvesicles (GFvsDP-1)
GSE124492	Dental pulp cell-derived powerful inducer of TNF-alpha comprises PKR containing stress granule rich microvesicles
GSE124679	Integrated miRNA and mRNA expression analysis uncovers drug targets in squamous cell carcinoma patients
GSE125401	Transcription profiles of human dermal papilla cells cultured under 20%-O2 or 6%-O2 condition
GSE125402	Transcription profiles of human dermal sheath cells cultured under 20%-O2 or 6%-O2 condition
GSE128309	MicroRNA and mRNA regulatory network in ALK-rearranged lung adenocarcinoma [mRNA]
GSE128311	MicroRNA and mRNA regulatory network in ALK-rearranged lung adenocarcinoma
GSE130092	rBC2LCN-positive subpopulation of PC-3 cells exhibits cancer stem-like properties
GSE130441	CYGB+ expressing vs non cytoglobin expressing cells (NCE) (MOCK)
GSE131247	Decreased SATB1 expression promotes AML cell proliferation through NF-κB activation
GSE131787	Identification of CLDN6 as a novel tumor-promoting gene in gastric cancer
GSE132518	Genes regulated by SMAD3 in HCC cells
GSE134310	Machine Learning Classification of Peripheral Blood Gene Expression Identifies at Baseline Subsets of Patients with Systemic Sclerosis Most Likely to Show Clinical Improvement in Response to Autologous Myeloablative Hematopoietic Stem Cell Transplantation
GSE138233	Transcriptomic analysis of DOXO-Resistant cells compared to parental DOXO-Sensitive mda-mb-436 cell line
GSE139669	SLC35F2 is Essential for Proliferation and Osteogenic Differentiation of Bone Marrow-Derived Human Mesenchymal Stem Cells
GSE139670	rBC2LCN lectin detects early-stage HER2-positive breast cancer
GSE143846	Stromal cell signature associated with response to neoadjuvant chemotherapy in locally advanced breast cancer
GSE148398	Gene expression of invasive lobular carcinoma tumor epithelium and tumor stroma isolated by laser-capture microdissection
GSE149717	Gene expression analysis of human pluripotent stem cells maintained on several laminin-E8 scaffolds.
GSE151239	Comparative analysis between effects of thalidomide and environmental chemicals on neuronal differentiations in human sphere
GSE153717	T-cell acute lymphobalstic leukemia xenografts in NOD/SCID mouse
GSE153750	Cross-talk between GLI transcription factors and FOXC1 promotes T-cell acute lymphoblastic leukemia dissemination
GSE159101	The role of ESRG in human pluripotency II
GSE165629	Human PDAC Cells: scramble Control vs. RINT shRNA downregulated
GSE168621	Dual tumor and normal biopsies from various cancer patients
GSE171478	HCT116 colorectal cancer cells treated with 2.5 mM Metformin
GSE171702	Genomic and transcriptomic profiling expands precision cancer medicine: the WINTHER trial (Lung patients)
GSE181963	A Minimal Subset of Seven Genes Associated with Tumor Hepatocyte Differentiation Predicts a Poor Prognosis in Human Hepatocellular Carcinoma
GSE182358	miR-200 is associated with sensitivity of gastric diffuse large B-cell lymphoma to H. pylori eradication therapy
GSE182362	miR-155-regulated mTOR and Toll-like receptor 5 in gastric diffuse large B-cell lymphoma
GSE188505	Human MCF7 cells engineered to overexpress MYF6 vs. Control cells containing empty vector constructs [Rec1]
GSE188537	Human MCF7 cells engineered to overexpress MYF6 vs. Control cells containing empty vector constructs [Rec2]
GSE188609	MYF6 suppresses cell growth through inhibition of Akt and Wnt signaling in ER-positive breast cancer
GSE193500	Modeling androgen deprivation therapy-induced prostate cancer dormancy and its clinical implications
GSE201468	A clinical-grade HLA haplobank of human induced pluripotent stem cells derived from Japanese donors
GSE205155	Inter-layer and inter-subject variability of circadian gene expression in human skin
GSE209983	Gene expression signature of EpCAMlow/PDPN+ and EpCAMhigh/PDPN- cancer cells in engineered human NSCLC HSAEC_4T53RD mouse xenograft model.
GSE210284	Investigation of the anti-tumor mechanism of tirabrutinib, a highly selective Bruton’s tyrosine kinase inhibitor, by transcriptomics
GSE230084	Human induced pluripotent stem cell culture on a non-coated dish using medium supplemented with milk fat globule epidermal growth factor 8
GSE252845	Effects of Apigenin and Rutaecarpine on Gene Expression Profiling of Human BMSC-derived osteoblasts [Microarray]
GSE269782	Defective N-Glycosylation of IL6 Induces Metastasis and Tyrosine Kinase Inhibitor Resistance in Lung Cancer

Data table

SPOT_ID

CONTROL_TYPE

REFSEQ

GB_ACC

GENE

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

TIGR_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

(+)E1A_r60_1

pos

(+)E1A_r60_3

pos

(+)E1A_r60_a104

pos

(+)E1A_r60_a107

pos

(+)E1A_r60_a135

pos

(+)E1A_r60_a20

pos

(+)E1A_r60_a22

pos

(+)E1A_r60_a97

pos

(+)E1A_r60_n11

pos

(+)E1A_r60_n9

pos

3xSLv1

neg

A_19_P00315452

FALSE

lincRNA:chr18:59273300-59274144_R

chr18:59273360-59273301

hs|18q21.33

lincRNA:chr18:59273300-59274144 reverse strand

GACTGACGACAAGAAGGCTCTTCGTCCCTGTTTTTGAAATAAACATGGGTATAATCTGAA

A_19_P00315459

FALSE

lincRNA:chrX:149128983-149131423_F

chrX:149131107-149131166

hs|Xq28

lincRNA:chrX:149128983-149131423 forward strand

AGCCCCCACTGTTCCACTTATTGTGATGGTTTGTATATCTTTATTTCAAAGAAGATCTGT

A_19_P00315469

FALSE

lincRNA:chr3:106959773-107004511_R

chr3:106959833-106959774

hs|3q13.11

lincRNA:chr3:106959773-107004511 reverse strand

GCAAATCGGAATCCACGGAAGAAAATTCACCTCTTAAGGATCCAGTCCGGAAAGGGATGG

A_19_P00315473

FALSE

lincRNA:chr3:156817296-156818920_R

chr3:156817360-156817301

hs|3q25.31

lincRNA:chr3:156817296-156818920 reverse strand

ACTGAACAGAACAGGCAGGAGGTATTTTCTTCTGAAGAGCTGTCAAGAGCCAATACAGCA

A_19_P00315482

FALSE

lincRNA:chr6:22136433-22147296_R

chr6:22136556-22136497

hs|6p22.3

lincRNA:chr6:22136433-22147296 reverse strand

GAATCGGAGGTGCCTGGGTCATCTCACAGAGCCAAACAAATACAATTAGCTATTGCAAAG

A_19_P00315490

FALSE

lincRNA:chr15:67276445-67351512_F

chr15:67278776-67278835

hs|15q23

lincRNA:chr15:67276445-67351512 forward strand

TCAGCATCCCGAGAGAATGCAAGATGTTGTGACCAAGGTGTCTAAATATCAAACGCAAGT

A_19_P00315492

FALSE

lincRNA:chr4:129376323-129391820_F

chr4:129376376-129376435

hs|4q28.2

lincRNA:chr4:129376323-129391820 forward strand

AGGCAGCCTTGCTGTTGGGGGTTATTGGCAGCTGTTGGGGGTTAGAGACAGGACTCTCAT

A_19_P00315493

FALSE

lincRNA:chr14:71954577-71956430_F

chr14:71956255-71956314

hs|14q24.2

lincRNA:chr14:71954577-71956430 forward strand

ATATATTCTTCAGTGTGATTTAGGTGAGTCAGGAATTTTTCCTCTGGAGACTGCCTAAAT

A_19_P00315496

FALSE

lincRNA:chr3:162937703-162996391_F

chr3:162993048-162993107

hs|3q26.1

lincRNA:chr3:162937703-162996391 forward strand

TATTTATCATTGCTGTCATTCATTTCAAAGACGGGAATGTCAGAATGTCTTGTGCGGGGT