NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15790 Query DataSets for GPL15790
Status Public on Jul 12, 2012
Title A-UMCU-M44K-2.0
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer Holstege Lab, UMC Utrecht, The Netherlands
Manufacture protocol 1. Slides are obtained from a commercial provider (Agilent) and reannotated using blat to obtain the latest gene annotations from ensembl.
Support glass
 
 
Web link http://microarrays.holstegelab.nl
Contributor(s) van Leenen D, Groot Koerkamp M, Lijnzaad P, Bakker L, Sluiters E, van Hooff S, Kemmeren P, Holstege F
Submission date Jul 11, 2012
Last update date Jan 18, 2013
Contact name Sander van Hooff
E-mail(s) s.r.vanhooff@umcutrecht.nl
Organization name UMC Utrecht
Department Department of Molecular Cancer Research
Lab Holstege Lab
Street address Universiteitsweg 100
City Utrecht
State/province Utrecht
ZIP/Postal code 3584 CG
Country Netherlands
 
Samples (16) GSM988387, GSM988388, GSM988389, GSM988390, GSM1014607, GSM1014608 
Series (2)
GSE40208 JeB001: Elucidation of the distal convoluted tubule transcriptome identified new candidate players in magnesium balance
GSE41320 MWi001: Identification of Srp9 as a febrile seizure susceptibility gene

Data table header descriptions
ID primary identifier
METACOLUMN metagrid column position
METAROW metagrid row position
COLUMN grid column position
ROW grid row position
SPOT_ID alternative spot identifier
SUPPLIER_ID original supplier id, e.g. from agilent or operon
REPORTER_GROUP class the reporter belongs to, e.g. controls or genes
SEQUENCE nucleotide sequence
SYSTEMATIC_NAME systematic name of the gene
GENE_SYMBOL Gene symbol for the gene
ORGANISM organism
PRIMARY_DB primay external database identifier, format is <extdb>:<identifier>
ORF

Data table
ID METACOLUMN METAROW COLUMN ROW SPOT_ID SUPPLIER_ID REPORTER_GROUP SEQUENCE SYSTEMATIC_NAME GENE_SYMBOL ORGANISM PRIMARY_DB ORF
1 1 1 1 1 QCAA003686 GE_BrightCorner qc_control
2 1 1 2 1 QCAA003686 GE_BrightCorner qc_control
3 1 1 3 1 QCAA000454 DarkCorner qc_control
4 1 1 4 1 QCAA000454 DarkCorner qc_control
5 1 1 5 1 QCAA000454 DarkCorner qc_control
6 1 1 6 1 QCAA000454 DarkCorner qc_control
7 1 1 7 1 QCAA000454 DarkCorner qc_control
8 1 1 8 1 QCAA000454 DarkCorner qc_control
9 1 1 9 1 QCAA000454 DarkCorner qc_control
10 1 1 10 1 QCAA000454 DarkCorner qc_control
11 1 1 11 1 QCAA000454 DarkCorner qc_control
12 1 1 12 1 QCAA000454 DarkCorner qc_control
13 1 1 13 1 QCAA000454 DarkCorner qc_control
14 1 1 14 1 QCAA000454 DarkCorner qc_control
15 1 1 15 1 QCAA000454 DarkCorner qc_control
16 1 1 16 1 QCAA000454 DarkCorner qc_control
17 1 1 17 1 QCAA000454 DarkCorner qc_control
18 1 1 18 1 QCAA000454 DarkCorner qc_control
19 1 1 19 1 QCAA000454 DarkCorner qc_control
20 1 1 20 1 MMAC009219 A_52_P361081 gene ACCTGAGCTACACCGGGTAACAGTGTCATTGAAGACACCATAGGGTTACCTCCCAGCTGC ENSMUSG00000029032 Arhgef16 Mus musculus ensembl:ENSMUSG00000029032 Arhgef16

Total number of rows: 45220

Table truncated, full table size 7258 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap