GEO help: Mouse over screen elements for information.
Status
Public on Apr 05, 2013
Title
Agilent-045997 Arraystar human lncRNA microarray V3 (Probe Name Version)
Technology type
in situ oligonucleotide
Distribution
custom-commercial
Organism
Homo sapiens Manufacturer
Agilent Technologies
Manufacture protocol
see manufacturer's web site at http://www.agilent.com/
Submission date
Apr 03, 2013
Last update date
Mar 12, 2018
Contact name
Panos Pan
E-mail(s)
panosp@arraystar.com Phone
888-416-6343
Organization name
Arraystar Inc.
Street address
9430 Key West Avenue
City
Rockville
State/province
MD
ZIP/Postal code
20850
Country
USA
Samples (1450)
GSM1330522 , GSM1330523 , GSM1330524 , GSM1330525 , GSM1330526 , GSM1330527
GSM1431249 ,
GSM1431250 ,
GSM1431251 ,
GSM1431252 ,
GSM1431253 ,
GSM1431254 ,
GSM1431255 ,
GSM1431256 ,
GSM1431257 ,
GSM1431258 ,
GSM1485226 ,
GSM1485227 ,
GSM1485228 ,
GSM1485229 ,
GSM1498849 ,
GSM1498850 ,
GSM1498851 ,
GSM1498852 ,
GSM1498853 ,
GSM1498854 ,
GSM1498855 ,
GSM1498856 ,
GSM1498857 ,
GSM1498858 ,
GSM1498859 ,
GSM1498860 ,
GSM1502864 ,
GSM1502865 ,
GSM1502866 ,
GSM1502867 ,
GSM1502868 ,
GSM1502869 ,
GSM1502870 ,
GSM1502871 ,
GSM1502872 ,
GSM1502873 ,
GSM1502874 ,
GSM1502875 ,
GSM1502876 ,
GSM1502877 ,
GSM1502878 ,
GSM1502879 ,
GSM1502880 ,
GSM1502881 ,
GSM1502882 ,
GSM1502883 ,
GSM1502884 ,
GSM1553567 ,
GSM1553568 ,
GSM1553569 ,
GSM1553570 ,
GSM1553571 ,
GSM1553572 ,
GSM1553573 ,
GSM1553574 ,
GSM1553575 ,
GSM1553576 ,
GSM1553577 ,
GSM1553578 ,
GSM1553579 ,
GSM1553580 ,
GSM1553581 ,
GSM1553582 ,
GSM1553583 ,
GSM1553584 ,
GSM1553585 ,
GSM1553586 ,
GSM1553587 ,
GSM1553588 ,
GSM1553589 ,
GSM1553590 ,
GSM1553591 ,
GSM1553592 ,
GSM1553593 ,
GSM1553594 ,
GSM1553595 ,
GSM1553596 ,
GSM1553597 ,
GSM1553598 ,
GSM1553599 ,
GSM1553600 ,
GSM1553601 ,
GSM1553602 ,
GSM1553603 ,
GSM1553604 ,
GSM1553605 ,
GSM1553606 ,
GSM1553607 ,
GSM1553608 ,
GSM1553609 ,
GSM1553610 ,
GSM1553611 ,
GSM1553612 ,
GSM1553613 ,
GSM1553614 ,
GSM1553615 ,
GSM1553616 ,
GSM1553617 ,
GSM1553618 ,
GSM1553619 ,
GSM1553620 ,
GSM1553621 ,
GSM1553622 ,
GSM1553623 ,
GSM1553624 ,
GSM1553625 ,
GSM1553626 ,
GSM1553627 ,
GSM1553628 ,
GSM1553629 ,
GSM1553630 ,
GSM1553631 ,
GSM1553632 ,
GSM1553633 ,
GSM1553634 ,
GSM1553635 ,
GSM1553636 ,
GSM1553637 ,
GSM1553638 ,
GSM1553639 ,
GSM1553640 ,
GSM1553641 ,
GSM1553642 ,
GSM1553643 ,
GSM1553644 ,
GSM1553645 ,
GSM1553646 ,
GSM1553647 ,
GSM1553648 ,
GSM1553649 ,
GSM1553650 ,
GSM1553651 ,
GSM1553652 ,
GSM1553653 ,
GSM1553654 ,
GSM1553655 ,
GSM1553656 ,
GSM1553657 ,
GSM1553658 ,
GSM1553659 ,
GSM1553660 ,
GSM1553661 ,
GSM1553662 ,
GSM1553663 ,
GSM1553664 ,
GSM1553665 ,
GSM1553666 ,
GSM1553667 ,
GSM1553668 ,
GSM1553669 ,
GSM1553670 ,
GSM1553671 ,
GSM1553672 ,
GSM1553673 ,
GSM1553674 ,
GSM1553675 ,
GSM1553676 ,
GSM1553677 ,
GSM1553678 ,
GSM1553679 ,
GSM1553680 ,
GSM1553681 ,
GSM1553682 ,
GSM1553683 ,
GSM1553684 ,
GSM1553685 ,
GSM1553686 ,
GSM1553687 ,
GSM1553688 ,
GSM1553689 ,
GSM1553690 ,
GSM1553691 ,
GSM1553692 ,
GSM1553693 ,
GSM1553694 ,
GSM1553695 ,
GSM1553696 ,
GSM1553697 ,
GSM1553698 ,
GSM1553699 ,
GSM1553700 ,
GSM1553701 ,
GSM1553702 ,
GSM1553703 ,
GSM1553704 ,
GSM1553705 ,
GSM1553706 ,
GSM1553707 ,
GSM1553708 ,
GSM1553709 ,
GSM1553710 ,
GSM1553711 ,
GSM1553712 ,
GSM1553713 ,
GSM1553714 ,
GSM1585375 ,
GSM1585376 ,
GSM1603908 ,
GSM1603909 ,
GSM1603910 ,
GSM1603911 ,
GSM1603912 ,
GSM1603913 ,
GSM1869540 ,
GSM1869541 ,
GSM1869542 ,
GSM1869543 ,
GSM1869544 ,
GSM1869545 ,
GSM1869546 ,
GSM1869547 ,
GSM1869548 ,
GSM1869549 ,
GSM1876205 ,
GSM1876206 ,
GSM1893162 ,
GSM1893163 ,
GSM1893164 ,
GSM1893165 ,
GSM1893166 ,
GSM1893167 ,
GSM1893168 ,
GSM1893169 ,
GSM1893170 ,
GSM1893171 ,
GSM1904127 ,
GSM1904128 ,
GSM1904129 ,
GSM1904130 ,
GSM1904131 ,
GSM1904132 ,
GSM1904133 ,
GSM1904134 ,
GSM1904135 ,
GSM1904136 ,
GSM1904137 ,
GSM1904138 ,
GSM1904139 ,
GSM1904140 ,
GSM1904141 ,
GSM1936718 ,
GSM1936719 ,
GSM1936720 ,
GSM1936721 ,
GSM1936722 ,
GSM1936723 ,
GSM1936724 ,
GSM1936725 ,
GSM1936726 ,
GSM1936727 ,
GSM1936728 ,
GSM1936729 ,
GSM1941515 ,
GSM1941516 ,
GSM1941517 ,
GSM1941518 ,
GSM1941519 ,
GSM1941520 ,
GSM1941521 ,
GSM1941522 ,
GSM1941523 ,
GSM1941524 ,
GSM1941525 ,
GSM1941526 ,
GSM1942514 ,
GSM1942515 ,
GSM1942516 ,
GSM1942517 ,
GSM1942518 ,
GSM1942519 ,
GSM1942520 ,
GSM1942521 ,
GSM1942522 ,
GSM1955436 ,
GSM1955437 ,
GSM1955438 ,
GSM1955439 ,
GSM1955440 ,
GSM1955441 ,
GSM2042464 ,
GSM2042465 ,
GSM2042466 ,
GSM2042467 ,
GSM2042468 ,
GSM2042469 ,
GSM2042470 ,
GSM2042471 ,
GSM2042472 ,
GSM2042473 ,
GSM2042474 ,
GSM2042475 ,
GSM2042476 ,
GSM2042477 ,
GSM2042478 ,
GSM2042479 ,
GSM2042480 ,
GSM2042481 ,
GSM2042482 ,
GSM2047222 ,
GSM2047223 ,
GSM2047224 ,
GSM2047225 ,
GSM2047226 ,
GSM2047227 ,
GSM2050617 ,
GSM2050618 ,
GSM2050619 ,
GSM2050620 ,
GSM2050621 ,
GSM2050622 ,
GSM2066255 ,
GSM2066256 ,
GSM2066257 ,
GSM2066258 ,
GSM2066259 ,
GSM2066260 ,
GSM2097525 ,
GSM2097526 ,
GSM2141900 ,
GSM2141901 ,
GSM2141902 ,
GSM2141903 ,
GSM2141904 ,
GSM2141905 ,
GSM2181594 ,
GSM2181595 ,
GSM2181596 ,
GSM2181597 ,
GSM2181598 ,
GSM2181599 ,
GSM2181600 ,
GSM2181601 ,
GSM2181602 ,
GSM2181603 ,
GSM2181604 ,
GSM2181605 ,
GSM2181606 ,
GSM2181607 ,
GSM2181608 ,
GSM2181609 ,
GSM2181610 ,
GSM2181611 ,
GSM2181612 ,
GSM2181613 ,
GSM2181614 ,
GSM2182746 ,
GSM2182747 ,
GSM2190604 ,
GSM2190605 ,
GSM2190606 ,
GSM2190607 ,
GSM2190608 ,
GSM2190609 ,
GSM2195410 ,
GSM2195411 ,
GSM2195412 ,
GSM2195413 ,
GSM2195414 ,
GSM2195415 ,
GSM2247223 ,
GSM2247224 ,
GSM2247225 ,
GSM2247226 ,
GSM2247227 ,
GSM2247228 ,
GSM2247229 ,
GSM2247230 ,
GSM2247231 ,
GSM2251406 ,
GSM2251407 ,
GSM2251408 ,
GSM2251409 ,
GSM2251410 ,
GSM2251411 ,
GSM2251632 ,
GSM2251633 ,
GSM2251634 ,
GSM2251635 ,
GSM2251636 ,
GSM2251637 ,
GSM2251638 ,
GSM2251639 ,
GSM2251640 ,
GSM2251641 ,
GSM2251642 ,
GSM2251643 ,
GSM2255433 ,
GSM2255434 ,
GSM2255435 ,
GSM2255436 ,
GSM2255437 ,
GSM2255438 ,
GSM2255439 ,
GSM2255440 ,
GSM2255441 ,
GSM2255442 ,
GSM2255443 ,
GSM2255444 ,
GSM2256428 ,
GSM2256429 ,
GSM2256430 ,
GSM2256431 ,
GSM2256432 ,
GSM2256433 ,
GSM2256434 ,
GSM2256435 ,
GSM2259994 ,
GSM2259995 ,
GSM2259996 ,
GSM2259997 ,
GSM2259998 ,
GSM2259999 ,
GSM2260000 ,
GSM2260001 ,
GSM2260002 ,
GSM2260003 ,
GSM2260004 ,
GSM2260005 ,
GSM2260006 ,
GSM2260007 ,
GSM2260008 ,
GSM2260009 ,
GSM2260010 ,
GSM2260011 ,
GSM2260012 ,
GSM2260013 ,
GSM2260014 ,
GSM2260015 ,
GSM2260016 ,
GSM2260017 ,
GSM2260018 ,
GSM2260019 ,
GSM2260020 ,
GSM2260021 ,
GSM2260022 ,
GSM2260023 ,
GSM2309352 ,
GSM2309353 ,
GSM2350370 ,
GSM2350371 ,
GSM2350372 ,
GSM2350373 ,
GSM2350374 ,
GSM2350375 ,
GSM2357028 ,
GSM2357029 ,
GSM2357030 ,
GSM2357031 ,
GSM2357032 ,
GSM2357033 ,
GSM2357034 ,
GSM2357035 ,
GSM2357036 ,
GSM2357037 ,
GSM2357038 ,
GSM2357039 ,
GSM2357040 ,
GSM2357041 ,
GSM2357042 ,
GSM2357043 ,
GSM2357044 ,
GSM2357045 ,
GSM2357046 ,
GSM2357047 ,
GSM2357048 ,
GSM2357049 ,
GSM2357050 ,
GSM2357051 ,
GSM2357052 ,
GSM2357053 ,
GSM2358831 ,
GSM2358832 ,
GSM2358833 ,
GSM2358834 ,
GSM2358835 ,
GSM2358836 ,
GSM2358837 ,
GSM2358838 ,
GSM2358839 ,
GSM2358840 ,
GSM2359021 ,
GSM2359022 ,
GSM2359023 ,
GSM2359024 ,
GSM2359025 ,
GSM2359026 ,
GSM2359027 ,
GSM2359028 ,
GSM2359029 ,
GSM2359533 ,
GSM2359534 ,
GSM2359535 ,
GSM2359536 ,
GSM2359537 ...
Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here Series (152)
GSE55146 Aberrant expression of long noncoding RNA in vivo in the cystic fibrosis bronchial epithelium.
GSE59245 Long noncoding RNAs expression patterns associated with chemo response to cisplatin based chemotherapy in lung squamous cell carcinoma patients
GSE60689 Identification of LncRNA Expression Signatures for Triple-negative Breast Cancer
GSE61166 Global mRNA/LncRNA expression analysis of pancreatic tumors causing type3C Diabetes Mellitus
GSE61359 Long noncoding RNAs profiles of adrenocortical carcinomas, adrenocortical adenomas and normal adrenal cortex
GSE63614 Expression and Prognostic impact of LncRNAs in AML
GSE64975 SK-NEP-1 treated with LBH589
GSE65737 Differential microarray expression profile analysis of long non-coding RNAs in umbilical cord vein plasma from normal and gestational diabetes-induced macrosomia
GSE72756 Genome-wide analysis of long noncoding RNA expression profile in non-alcoholic fatty liver disease
GSE72980 SK-NEP-1 treated with SKI-5C
GSE73414 Identification of long non-coding RNAs associated with aberrant LKB1 signaling
GSE73830 Whole Blood long non-coding RNA and mRNA Expression Profiles in Humans Exposed to Multi-walled Carbon Nanotubes
GSE74858 Long-noncoding RNAs in basal cell carcinoma
GSE74859 Long non-coding RNAs in cutaneous squamous cell carcinoma
GSE75050 Genome-wide analysis of long noncoding RNA (lncRNA) expression in colorectal cancer tissues from patients with liver metastasis
GSE75092 The long noncoding RNA expression profiles of paroxysmal atrial fibrillation identified by microarray analysis
GSE75459 Plasma Long Noncoding RNA and mRNA Expression Profile of Crohn’s Disease identified by Microarray
GSE77013 A long noncoding RNA signature in Ulcerative Colitis
GSE77279 The long non-coding RNA(lncRNA) expression profiles in human aortic vascular smooth muscle cells (HAVSMCs)
GSE77280 Long non-coding and circular RNA expression profiles in human aortic vascular smooth muscle cells (HAVSMCs)
GSE77355 mRNA expression profile in Al2O3 nanoparticle treated A549 cells
GSE78074 Differentially expressed long noncoding RNA expression between periodontal ligament stem cells from healthy periodontal tissue and periodontal ligament stem cells from inflammatory periodontal tissue.
GSE79540 Identification of LncRNA Expression Signatures for breast cancer brain metastasis (BCBM)
GSE81060 Molecular mechanism of the G1 arrest and cellular senescence induced by LEE011, novel CDK4/CDK6 inhibitor, in acute myeloid leukemia cells
GSE82033 Genome-wide expression profiling of human prostate stromal cells in response to multiple chemotherapeutic agents
GSE82059 Cancer-associated fibroblasts-secreted CXCL14-regulated LINC00092 mediates ovarian cancer progression by altering glycolysis
GSE82335 Diesel exhaust particle (DEP)-treated HBE cells
GSE83147 RNA expression profiles in fibroblast-like synoviocytes from rheumatoid arthritis patients and trauma patients
GSE84654 Comprehensive lncRNAs expression profiling reveals the potential role of lncRNAs in systemic lupus erythematosus [Human LncRNA Array v3.0]
GSE84656 Comprehensive expression profiling reveals the potential role of lncRNAs and circRNAs in systemic lupus erythematosus
GSE84790 lncRNA expression profiles in OSCC cells cultured under normoxic and hypoxic conditions
GSE84805 Aberrant lncRNA expression profiles in OSCC tissues compared with paired normal oral mucosa
GSE84807 Long noncoding RNA HAS2-AS1 mediates hypoxia-induced invasiveness of oral squamous cell carcinoma
GSE84983 Long noncoding RNA (lncRNA) expression profiles in colorectal cancer tissues and paired adjacent normal tissues
GSE85030 lncRNA expression in leukemia
GSE85192 lncRNA Expression Signatures in Response to Jiangtang Tiaozhi Formular in T2DM with Obesity and Hyperlipidemia
GSE86852 Genes expression after ZNF717 knockdown in liver cancer
GSE88862 Examine the expression profiles of lncRNAs in early stage lung squamous cell carcinoma
GSE89005 Changes of lncRNA expression in primary human skin fibroblasts after irradiation with UVA or UVB
GSE89006 Expression profiles of lncRNAs in bladder cancer
GSE89102 LncrRNA and mRNA expression profiling in human esophageal squamous cancer
GSE89114 Deregulation of lncRNAs by Kaposi's sarcoma-associated herpesvirus
GSE89139 Expression data from pancreatic ductal adenocarcinoma
GSE89330 Identification and characterization of long non-coding RNAs in osteogenic differentiation of human adipose-derived stem cells
GSE89552 Transcriptional Profiling of Dysregulated lncRNAs in B cells Response to Active Tuberculosis
GSE89804 Long non-coding RNAs and mRNAs in nasopharyngeal carcinoma metastasis
GSE90524 Genome-wide analysis of long noncoding RNA expression profile in colorectal cancer
GSE90866 Genome-wide transcript profiling of human prostate stromal cells in response to genotoxic treatment and SASP inhibitors
GSE92414 Identification of lipid-binding lncRNAs in triple-negative breast cancer
GSE92498 Different LncRNAs in exosomes derived from skov-3 cells when exposed to normal or hypoxia condition
GSE92681 Differential Expression of LncRNAs and mRNAs in normal and inflamed human pulp
GSE93608 Comparison of HBO1 siRNA-treated Human Umbilical Vein Endothelial Cells (HUVECs) and control siRNA-treated HUVECs
GSE93625 Human colon cancer SW480 cells: stably transfected with vector control and LRP16 treated with or without etoposide
GSE93789 The long noncoding RNAs and mRNAs in the hepatocellular carcinoma at early and intermediate stage
GSE95087 TSA induced gene expression variation on breast cancer cell SKBR3
GSE95186 lncRNA and mRNA expression responsive to p53 that induced by doxycycline
GSE95423 lncRNA expression of CRC liver metastasis
GSE95728 Long noncoding RNA expression profiles in granulosa cells from PCOS patients and women with normal ovarian reserve
GSE97210 LncRNA/mRNA expression profiling for human normal arterial intimae and advanced atherosclerotic plaques
GSE97336 Microarray expression profile of long noncoding RNAs in germinal center-like diffuse large B-cell lymphoma cell lines.
GSE97530 Aberrantly Expressed Long Non-coding RNAs In CD8+ T Cells Response to Active Tuberculosis
GSE97967 HNF1A-AS1, as competing endogenous RNA (ceRNA), is involved in VEGF-C-mediated PI3K signaling pathway in gastric cancer
GSE98591 Tumor-derived exosomal lnc-Sox2ot promotes EMT and stemness by acting as a ceRNA in pancreatic carcinoma
GSE98929 lncRNA/mRNA expression profiling for 10 human lung samples
GSE99416 Non-coding RNAs participate in the regulatory network of CLDN4 via ceRNA-mediated miRNA evasion (lncRNA)
GSE99417 Non-coding RNAs participate in the regulatory network of CLDN4 via ceRNA-mediated miRNA evasion
GSE101081 mRNA expression after knockdowwn of UICLM in SW620 cells
GSE101805 Differential Expression of Long Non-Coding RNAs in Patients with Tuberculosis Infection
GSE102524 Inflammatory Bowel Disease-specific alterations in adipose-derived stroma cell transcriptional profiles
GSE102547 LncRNA expression profiling for 9 human plasma samples from systemic lupus erythematosus patients and healthy controls
GSE103227 mRNA and lncRNA expression profiling in human brain glioblastoma
GSE103229 mRNA, lncRNA and microRNA expression profiling in human brain glioblastoma
GSE104364 lncRNA and mRNA expression profile in colorectal adenoma and cancer
GSE105053 Gene expression signitures in ARPE-19 cells treated with or without TGF-β1
GSE105107 Comparative study of mRNAs and lncRNAs in endothelial and non-endothelial cells
GSE106074 Cell-free lncRNA expression signatures in urine serve as novel noninvasive biomarkers for diagnosis and recurrence prediction of bladder cancer
GSE106671 Gene expression signatures of highly metastatic gallbladder cancer cells
GSE106729 Identification of glucose-regulated lncRNAs in triple-negative breast cancer cells
GSE106916 Myc regulates gene expression in P493-6 cell lines which carry a Myc tet-off system
GSE107426 Results of differentially expressed lncRNAs in COPD and healthy smoker using the Arraystar Human LncRNA Microarray
GSE108139 An epigenomic approach to identifying differential overlapping and cis-acting lncRNAs in cisplatin-resistant cancer cells
GSE108554 Identificaion of long noncoding RNAs related to TGF-β signaling in human cultured tubular epithelial cells
GSE109454 Global lncRNA/mRNA expression analysis of colorectal tumor and non-tumor samples from 6 colorectal cancer patients
GSE110138 Genome-wide analysis of long noncoding RNA expression profile in patients with Marjolin’s ulcer
GSE111763 Expression profiling of lncRNAs/mRNA for H.pylori infected normal gastric epithelial cell line
GSE112848 different expression of RNAs between breast cancer and benign tissue
GSE113013 Comparison of atrial appendage tissues of patients with Valvular Heart Disease and patients with Valvular Heart Disease-Atrial Fibrillation
GSE113742 LncRNA expression in ectopic APC overexpressed CRC cell lines and control cells
GSE114929 Differential Expression of LncRNAs after cisplatin treatment in tongue squamous carcinoma cells
GSE115734 Microarray expression profile of long non-coding RNAs in human lung adenocarcinoma
GSE115856 lncRNA expression profile in CRC
GSE119090 lncRNA/mRNA expression profiling of miR-200c-overexpressing MDA-MB-231 cells
GSE119233 Identification of lncRNAs Differentially Expressed in Basal-like Breast Cancer
GSE122189 Analyses of long non-coding RNAs in human retinal endothelial cells following glucose treatment
GSE122530 LncRNA expression profiling in advanced resected gastric adenocarcinoma tissues
GSE123497 Age and poverty status alter the coding and noncoding transcriptome [White]
GSE123499 Age and poverty status alter the coding and noncoding transcriptome [African American]
GSE123500 Age and poverty status alter the coding and noncoding transcriptome
GSE124291 Long-term culture with charcoal-stripped serum effect on the androgen-dependent LNCaP prostate cancer cell line
GSE124362 LncRNA and mRNA expression in paired liver tissues (periparasitic liver tissues versus distal liver tissues) from alveolar echinococcosis (AE) patients
GSE124401 LncRNA expression data from human plasma of control donors and chronic HF patients
GSE124405 Circulating Long Non-coding RNA ENST00000507296 is a Prognostic Indicator in Patients with Dilated Cardiomyopathy
GSE124531 Long non-coding RNA expression profiling reveals LINC00271 as a prognostic marker in adrenocortical carcinoma
GSE124619 LncRNA expression in 95C/95D lung cancer cell line
GSE125870 Quantitative Analysis of lncRNAs expression profiles between TB patients and healthy controls
GSE126683 Long non-coding RNAs and mRNAs expression profilling in human nasopharyngeal carcinoma
GSE127981 Integrative Proteome, Transcriptome and DNA Methylome Analysis of Regulatory Networks During U937-derived Macrophage Polarization from an M2 to M1 Phenotype [array]
GSE127990 Long noncoding RNA profiling in HUVEC stimulated with IL-1β.
GSE128007 Integrative Proteome, Transcriptome and DNA Methylome Analysis of Regulatory Networks During U937-derived Macrophage Polarization from an M2 to M1 Phenotype
GSE128533 Human bone-marrow-derived mesenchymal stem cells: control vs. cells undergoing chondrogenesis
GSE130492 Screening on Platelet Non-coding RNA Expression Profiles Discloses Its Correlations with Low Residual Platelet Reactivity
GSE134069 LncRNA-ENST00000501520 promotes the proliferation of malignant-transformed BEAS-2B cells induced with coal tar pitch mediated by target genes
GSE134087 Analysis of differential expression profiles of Long noncoding RNA in peripheral blood of patients with active rheumatoid arthritis
GSE134525 CRC lncRNA/mRNA expression
GSE134552 Hes1 is Associated with Long Non-Coding RNAs in Colorectal Cancer
GSE135697 Differentially expressed lncRNA in biological premature ovarian insufficiency (bPOI)
GSE138172 LncRNA and mRNA expression in five paired lung tissues (lung cancer tissues versus nontumor tissues) from non-small cell lung cancer (NSCLC) patients
GSE138870 mRNAs and LncRNA microarray of HBE cell exposed to Al2O3 NPs, PM2.5, DEP
GSE142372 Shear stress-induced long non-coding RNA, NIMBUSS, is required for the KLF2-mediated gene expression profile associated with vascular homeostasis I
GSE142373 Shear stress-induced long non-coding RNA, NIMBUSS, is required for the KLF2-mediated gene expression profile associated with vascular homeostasis II
GSE144789 Differentially expressed lncRNA&mRNA between macrophage M0 and macrophage M2 cells
GSE147530 RELA knockdown on gene expression in KG1α leukemia cells upon DNA damage
GSE150057 The long noncoding RNA and mRNA expression profiles of human temporomandibular joint synovial fluid derived mesenchymal stem cell altered by IL-1β
GSE154075 CDK13 upregulation-induced formation of the positive feedback loop among circCDK13, miR-212-5p/miR-449a and E2F5 contributes to prostate carcinogenesis
GSE155188 Increased long noncoding RNA maternally expressed gene 3 contributes to podocyte injury induced by high glucose through regulation of mitochondrial fission
GSE156144 LncRNA expression profile in triple negative breast cancer (TNBC)
GSE159507 Gene expression profifile during osteogenic differentiation of hPDLSCs was analyzed using microarray
GSE160888 RNA microarray analysis of human placenta in normal pregnancy and preeclampsia
GSE162173 lncRNA expression profile in placenta of diabetic macrosomia and normal birth weight newborn
GSE172364 Development of gene expression signatures for cisplatin resistance in gastric cancer cells
GSE173097 The different mRNA expression between cervical cancer tissues and normal cervical tissues
GSE176167 LncRNA HOXA-AS2 regulates microglial polarization via recuitment of PRC2 and epigenetic modification of PGC-1α expression
GSE178582 Expression signatures of long non-coding RNAs in Left ventricular Noncompaction
GSE178986 lncRNA expressions of the kidney tissues of DKD patients and controls
GSE180272 LncRNA expression-profiling to predict distant metastasis in locoregionally advanced nasopharyngeal carcinoma
GSE181614 RNA Sequencing facilitates quantitative analysis of lncRNA and mRNA expression in fibroblast-like synoviocytes from rheumatoid arthritis patients and trauma patients [microarray]
GSE181616 RNA Sequencing facilitates quantitative Analysis of differently expressed genes with negative control (NC) and siLINK-A treatment in rheumatoid fibroblast-like synoviocytes
GSE183466 Arraystar human lncRNA microarray V3.0
GSE186577 Colorectal cancer
GSE192560 Identification of long noncoding RNAs involved in clinicopathological features of papillary thyroid carcinoma complicated with Hashimoto's thyroiditis
GSE193626 Exploring the mechanism of Jiangtang Tiaozhi Recipe in the treatment of obese T2DM patients with dyslipidemia based on transcriptomics
GSE197376 Identifying target genes for the long noncoding RNA, GATA2-AS1
GSE199689 LncRNA and mRNA expression data from TMZ-resistant cell line
GSE221060 Long noncoding RNA expression profile of chemotherapy-sensitive and resistant breast cancer tissues
GSE221061 Long noncoding RNA expression profile of breast cancer tissues pre- and post-neoadjuvant chemotherapy
GSE221222 ATR/Chk1 interacting lncRNA modulates DNA damage response to induce breast cancer chemoresistance
GSE225345 Differentially expressed lncRNAs in hDPSCs between the OCT4A-overexpressing and vector groups.
GSE225635 Screen for the lncRNAs that are specificly upregulated in fetal liver by microarry analysis
GSE228568 The expression profile analysis of lncRNAs and mRNAs for cervical cancer
GSE233543 Development of gene expression signatures for HCV infection
GSE234546 mRNA expressiom profiling of breast cancer cell line MCF-7 and its endocrine-resistant lines
GSE278515 LNCRNA expression in pancreatic cancer tissues
Relations Alternative to
GPL24721 (Feature Number version)
Data table header descriptions ID probeID
TRANSCRIPT_TYPE protein-coding or noncoding
BUILD SEQUENCE SPOT_ID
Data table ID TRANSCRIPT_TYPE BUILD SEQUENCE SPOT_ID ASHGA5P000001
noncoding
HG19
GAGATAACTAGAACAGTGTCCCTCCCCTTTTATAACCTGTGTTTTTAGATTTCAAAAAGA
--unmapped
ASHGA5P000002
noncoding
HG19
CTAACTGTCAAACAAAGATGGGCTAATTAAACGGATGCCAACTAATCGGAAAACTTCTGG
--unmapped
ASHGA5P000003
noncoding
HG19
CCAGAAGCTCCAGCATGGTCCACCTACCAGAAGCTCCAGCATGATTTACCCATGAGTAGC
--unmapped
ASHGA5P000004
noncoding
HG19
TAAGTACGGTAATGCAAGAAGGTGCAGCAGGCGTAGTGCATTACAGCAACACTGAAAAAC
--unmapped
ASHGA5P000005
noncoding
HG19
TATGAGAGATGAAGAGATAAGGTCTAACTGTTACCTGGGCTGAACCCTTGGACTTCTAGG
--unmapped
ASHGA5P000006
noncoding
HG19
CAGTAGCGAGTATTTACTAAGTACTTTCTATTTGCGAGGCCCTGATAAAAGTACTGTCCT
--unmapped
ASHGA5P000007
noncoding
HG19
AATCTATTTATCTTCTCTGGAACTTCTTGTAATGCCGGGAGTGCAGAGCTTACAAGTTGG
--unmapped
ASHGA5P000008
noncoding
HG19
TAGCTGTAAGTAAGAATAGTTCATCACCCACTGCTGGGTTTGCATCCTCCTCCAAATAGG
--unmapped
ASHGA5P000009
noncoding
HG19
GAAATGTTTGTCTCTTCATGTTTCTCTGTCTTTCCCTTTCTCAAAGTAACAACTTGGGTT
--unmapped
ASHGA5P000010
noncoding
HG19
GACCATTCCAGTATCCTTACCTTACAGAAATGACAGCAACAACAGCAAATATGAGTAAAG
--unmapped
ASHGA5P000011
noncoding
HG19
AAGTCTCACAGAAATCCAGGAGACTTAAATGATCCAAGGGCAGGAAAGAAGGCTGCTCAT
--unmapped
ASHGA5P000012
noncoding
HG19
CTTCTGGATTTCAAATGTTGCTGTGCTCACAGAAACCTGATGGTTTACACACCAAGCAAT
--unmapped
ASHGA5P000013
noncoding
HG19
GGTGACTTACCTCAGTTGTAGGTATGAATCTATAGCCAAGGATTATGAAAACCTGAAGAA
--unmapped
ASHGA5P000014
noncoding
HG19
CTTCATTTAACCTTGTTGCTTTGAGTACTCCTAAAGCTTGTAATAATTCTTTGGGGAGTA
--unmapped
ASHGA5P000015
noncoding
HG19
GAAGCCTCAGGTGTATGCATGTCTGTTCGTATGTTGTCTACATAATACCAAGTTGACTTC
--unmapped
ASHGA5P000016
noncoding
HG19
GTTCCTACAGTGACAACTGGACCTGGCCCGAACCCCTGGCATCTGGCAACATTATTACCT
--unmapped
ASHGA5P000017
noncoding
HG19
TGGCAGCACGGCATATCCGCTGGCCTTCTGGGCACCAATGACAATGAAGCAGGCAATGAG
--unmapped
ASHGA5P000018
noncoding
HG19
CAGTCACTCTATGTCTTGCACCCAATTTAATGAATCTGAATTGATTATTCAGGTTGGTTT
--unmapped
ASHGA5P000019
noncoding
HG19
AACTCACCAGACCACAACTTGCAGCTCACAACACAACAGGAAGCTTAAAGATGCTTTGCT
--unmapped
ASHGA5P000020
noncoding
HG19
TTCTCCAGGATATTTTGGCCACAGACTTTATCATAAACTCCATCCCTTAGGGTGGCATTA
--unmapped
58944 5941 Kbytes .Supplementary data files not provided
Less...
More...