NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL1789 Query DataSets for GPL1789
Status Public on Jan 31, 2005
Title Affymetrix ENCODE Tiling Array - ANTISENSE - NCBIv34
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
 
Description 21bp resolution oligonucleotide tiling array.
Annotation in this record based on NCBI build 34.
 
Submission date Jan 10, 2005
Last update date Dec 13, 2005
Contact name Thomas R Gingeras
E-mail(s) tom_gingeras@affymetrix.com
Organization name Affymetrix, Inc.
Street address 3380 Central Expressway
City Santa Clara
State/province CA
ZIP/Postal code 95051
Country USA
 
Samples (79) GSM38704, GSM38705, GSM38706, GSM38707, GSM38708, GSM38709 
Series (18)
GSE2141 ENCODE: PolyA+ RNA from retinoic acid-stimulated HL60 cells at 4 timepoints (I) (NCBIv34)
GSE2142 ENCODE: RNAP transcription factor binding using Affymetrix genome tiling array (NCBIv34)
GSE2671 ENCODE Transcript Mapping for Human Placental Poly(A)+ RNA

Data table header descriptions
ID chromosome_genomic-position
SEQUENCE oligonucleotide probe sequence
top_strand_flag top strand flag: t (true) or f (false)
chr chromosome
genomic-coord genomic coordinate
PM_x x coordinate on 2-dimensional array of the corresponding PM feature in .cel file
PM_y y coordinate on 2-dimensional array of the corresponding PM feature in .cel file
MM_x x coordinate on 2-dimensional array of the corresponding MM feature in .cel file
MM_y y coordinate on 2-dimensional array of the corresponding MM feature in .cel file
top_strand_flag_2 top strand flag: t (true) or f (false) [for genomic coordinates to which multiple probes match]
PM_x_2 x coordinate on 2-dimensional array of the corresponding PM feature in .cel file [for genomic coordinates to which multiple probes match]
PM_y_2 y coordinate on 2-dimensional array of the corresponding PM feature in .cel file [for genomic coordinates to which multiple probes match]
MM_x_2 x coordinate on 2-dimensional array of the corresponding MM feature in .cel file [for genomic coordinates to which multiple probes match]
MM_y_2 y coordinate on 2-dimensional array of the corresponding MM feature in .cel file [for genomic coordinates to which multiple probes match]

Data table
ID SEQUENCE top_strand_flag chr genomic-coord PM_x PM_y MM_x MM_y top_strand_flag_2 PM_x_2 PM_y_2 MM_x_2 MM_y_2
chr1_148374651 TCGAGGCCTTAAGCTCTTGAGAGGT f chr1 148374651 35 959 35 960
chr1_148374672 AGGTTCCTGAGGACAGATTGGAATC f chr1 148374672 487 47 487 48
chr1_148374692 GAATCAGATACTGGGGAACAGAAGA f chr1 148374692 551 579 551 580
chr1_148374719 TCAGGAGAAATATGAGGATCTCAAT f chr1 148374719 736 1009 736 1010
chr1_148374740 CAATGAGAGAAAACTAGCATTGCCA f chr1 148374740 324 243 324 244
chr1_148374767 AATGGAAGTGGCATAGGGAGTACTG f chr1 148374767 129 213 129 214
chr1_148374787 TACTGGGACCTGATGAAAGAGAGAA f chr1 148374787 658 1083 658 1084
chr1_148374809 GAATAGGAATTGAGGAAATCCAAGA f chr1 148374809 820 523 820 524
chr1_148374824 AAATCCAAGACAACTAGGACTCCCC f chr1 148374824 1192 149 1192 150
chr1_148374846 CCCCTGTACCTTATAGGCCTTGGTG f chr1 148374846 148 399 148 400
chr1_148374865 TTGGTGACTACTCGGCGCTTCCTTC f chr1 148374865 246 1237 246 1238
chr1_148374886 CTTCTTGGCTCTTCTGCTTCTCCAT f chr1 148374886 833 367 833 368
chr1_148374906 TCCATCACTGGATGGTTCATCCCCT f chr1 148374906 830 939 830 940
chr1_148374927 CCCTTCATCAATGTCAAAGTCAGAG f chr1 148374927 1037 443 1037 444
chr1_148374949 GAGTCCACTTCGTCCTCTGTGTCTG f chr1 148374949 118 653 118 654
chr1_148374968 TGTCTGACTGGTCCCCTTGATACTC f chr1 148374968 1265 857 1265 858
chr1_148374991 TCATCATCTCCGGATTCCTAAGGAC f chr1 148374991 1185 997 1185 998
chr1_148375007 CCTAAGGACACAGGGAGATAAGGGT f chr1 148375007 531 473 531 474
chr1_148375029 GGTTGGCTGGCAATGGAAGCCTTAA f chr1 148375029 881 777 881 778
chr1_148375050 TTAATGCCCCTTCAGGAGGAACAGA f chr1 148375050 223 1105 223 1106

Total number of rows: 737680

Table truncated, full table size 57226 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap