NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL18889 Query DataSets for GPL18889
Status Public on Jan 29, 2015
Title Agilent-049577 Chicken gg_v2_60k 026441 [Feature Number Version]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Gallus gallus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Arrays of this design have barcodes that begin with 16049577 or 2549577.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.

 
Submission date Jul 02, 2014
Last update date Jan 29, 2015
Contact name Dirkjan Schokker
E-mail(s) dirkjan.schokker@wur.nl
Organization name Wageningen UR
Department Wageningen Livestock Research
Street address Droevendaalsesteeg 1
City Wageningen
ZIP/Postal code 6708 PB
Country Netherlands
 

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
NAME NAME
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
LOCUSLINK_ID LocuslinkID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID COL ROW NAME SPOT_ID CONTROL_TYPE REFSEQ GB_ACC LOCUSLINK_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
1 192 328 GE_BrightCorner GE_BrightCorner pos
2 192 326 DarkCorner DarkCorner pos
3 192 324 DarkCorner DarkCorner pos
4 192 322 A_87_P311492 A_87_P311492 FALSE NM_205289 NM_205289 396226 ITGA6 integrin, alpha 6 Gga.44589 ENSGALT00000038606 ref|NM_205289|ens|ENSGALT00000038606|gb|X56559|tc|TC374221 chr7:19103760-19103300 Gallus gallus integrin, alpha 6 (ITGA6), mRNA [NM_205289] GO:0007155(cell adhesion)|GO:0007229(integrin-mediated signaling pathway)|GO:0008305(integrin complex)|GO:0046872(metal ion binding) GGATGGATGTGAAAGCATGTTTTCAATATACTGCAAACCCTCGTAATTTAAATCCAAGAA
5 192 320 A_87_P304523 A_87_P304523 FALSE tc|TC443427 chr9:16060756-16062984 Rep: Activated CDC42 kinase 2 - Bos taurus (Bovine), partial (42%) [TC443427] AAAGCCATGTGCAAGCGGAAATCTTGGATGAGCAAGATCCTACACAAGATTGACAAGGAG
6 192 318 A_87_P121448 A_87_P121448 FALSE CR386026 Gga.22373 gb|CR386026|tc|TC431680|tc|TC385183|tc|TC394826 unmapped Gallus gallus finished cDNA, clone ChEST240i17. [CR386026] CCCACAGCGGGACTTTGTGTATGCCATTATTGTTACTGTAAATATTTTATCCTTTCATTT
7 192 316 A_87_P063016 A_87_P063016 FALSE ENSGALT00000006105 ens|ENSGALT00000006105 chr27:4167501-4167560 Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:F1NDN7] [ENSGALT00000006105] TGTTCTGCCAGGCACGGAGCAGAGCAGGGCAGATTGGGGAACCGCAGTCCATTTATATAG
8 192 314 A_87_P017523 A_87_P017523 FALSE CR354136 Gga.38132 gb|CR354136|tc|TC424631 chr4:565849-565908 Gallus gallus finished cDNA, clone ChEST849g12. [CR354136] AGTGTGGGGACAGGCAGGGAGCTGGGCTGGGAACCTGTTTGCTGAAGGATGCTCTTACTG
9 192 312 A_87_P057841 A_87_P057841 FALSE NM_001004375 NM_001004375 416651 HBAD alpha-D-globin Gga.2902 ENSGALT00000012068 ref|NM_001004375|ens|ENSGALT00000012068|ens|ENSGALT00000039703|gb|CR338842 chr14:12727477-12727536 Gallus gallus alpha-D-globin (HBAD), mRNA [NM_001004375] GO:0005344(oxygen transporter activity)|GO:0005506(iron ion binding)|GO:0005833(hemoglobin complex)|GO:0019825(oxygen binding)|GO:0020037(heme binding) GCTGCCTTCGACAAGTTCCTGTCTGCCGTGTCTGCTGTGCTGGCTGAGAAGTACAGATAA
10 192 310 NA NA ignore
11 192 308 A_87_P175568 A_87_P175568 FALSE unmapped TTCCAGAAACCAATAACAAGAAGGTATTGCTCATTCTAGAATCTCTGGAAGTCCAATTTT
12 192 306 A_87_P014550 A_87_P014550 FALSE CR389843 Gga.18165 gb|CR389843 chr11:19514389-19514330 Gallus gallus finished cDNA, clone ChEST271n5. [CR389843] AGGTCCTGAAATCCCCCAATTACGTTTTGTACCAAGAAATGAGTAATGCTCATTGCAAAC
13 192 304 A_87_P168643 A_87_P168643 FALSE chr10:011887476-011887417 ACAGACGTTTGCACATGAGCAGCAGATGAAAGAAGATAAGGTATTAATGCATCATATCAT
14 192 302 A_87_P227303 A_87_P227303 FALSE NM_001199546 NM_001199546 423655 JMJD1C jumonji domain containing 1C Gga.15746 ENSGALT00000004648 ref|NM_001199546|ens|ENSGALT00000004648|gb|CR386712|tc|TC405697 chr6:9069154-9069213 Gallus gallus jumonji domain containing 1C (JMJD1C), mRNA [NM_001199546] TTGCAAACAACAAAGCAGCGTTCTGCTGTCCTGTATTATAATGTACATGAAGTTTGTTAA
15 192 300 A_87_P118788 A_87_P118788 FALSE NM_001012603 NM_001012603 425297 GINS1 GINS complex subunit 1 (Psf1 homolog) Gga.42280 ENSGALT00000033314 ref|NM_001012603|ens|ENSGALT00000033314|ens|ENSGALT00000010139|ens|ENSGALT00000013913 chr3:17349594-17349652 Gallus gallus GINS complex subunit 1 (Psf1 homolog) (GINS1), mRNA [NM_001012603] CTGTGCCCTGGGAGAGCTCCACTGCTGCCAAATAAAAAACTGTTTCAGCTTTCAATGTTT
16 192 298 A_87_P272113 A_87_P272113 FALSE XM_424161 426522 GPATCH8 G patch domain containing 8 ENSGALT00000023249 ens|ENSGALT00000023249|tc|TC430517|tc|TC413784|tc|TC407233 chr27:1486151-1486210 G patch domain containing 8 [Source:HGNC Symbol;Acc:29066] [ENSGALT00000023249] ACTACAACAGGTCGAAGCGGCGTAAGTACTCCTCTTCTGAGGACTACAGCTCGAGCCGCA
17 192 296 A_87_P012300 A_87_P012300 FALSE CR407101 419965 FMNL1 formin-like 1 Gga.29828 gb|CR407101|gb|AJ851584|tc|TC427625|tc|TC417171 chr27:1352506-1352565 Gallus gallus finished cDNA, clone ChEST751g8. [CR407101] ACCGAGGGCCTGTTAAAGCAGAACTGGTAATAAACCGACCCCGAGGGTGAAGCGGTGTCT
18 192 294 A_87_P079201 A_87_P079201 FALSE XM_003641702 XM_003641702 424567 HYI hydroxypyruvate isomerase (putative) ENSGALT00000016276 ens|ENSGALT00000016276|ens|ENSGALT00000038577|ref|XM_003641702 chr8:20477474-20477415 hydroxypyruvate isomerase (putative) [Source:HGNC Symbol;Acc:26948] [ENSGALT00000016276] GCTGAACTTCCCCTACATCTTCAAGCTGCTGGAGTCCCTTGGCTACACTGGCTATGTGGG
19 192 292 A_87_P086537 A_87_P086537 FALSE NM_001004372 NM_001004372 415803 GCSH glycine cleavage system protein H (aminomethyl carrier) Gga.3298 ENSGALT00000008742 ref|NM_001004372|ens|ENSGALT00000008742|ens|ENSGALT00000039129|ens|ENSGALT00000033782 chrUn_random:3232123-3232182 Gallus gallus glycine cleavage system protein H (aminomethyl carrier) (GCSH), nuclear gene encoding mitochondrial protein, mRNA [NM_001004372] GO:0005739(mitochondrion)|GO:0005960(glycine cleavage complex)|GO:0019464(glycine decarboxylation via glycine cleavage system) GCATGATTCTGTTGGTTTTTTACTTCTTTACATAGTAAAATGGAGACGGAAAGCGTAAAG
20 192 290 NA NA ignore

Total number of rows: 62976

Table truncated, full table size 16433 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap