NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL20143 Query DataSets for GPL20143
Status Public on May 05, 2015
Title Agilent-027438 Yeast S-Y SNP v1 [Feature Number Version]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Saccharomyces cerevisiae
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Whole genome SNPs between S288c and YJM789. Both Watson and Crick strands represented as well as both probes specific to both strains.

In the labels of the oligonucleotides 'SF', 'SR', 'YF' and 'YR' refer to the orientation and origin of the sequences used for the oligonucleotides on the microarrays. 'S' and 'Y' indicate whether the oligonucleotide contains sequences identical to the reference S288c genome (closely related to W303-1A) or the YJM789 genome, respectively. 'F' and 'R' indicate whether the orientation (5' to 3') is identical to the orientation in SGD ('F' standing for forward) or opposite to that shown in SGD ('R' for reverse). Thus, 'F' and 'R' have the sequences of the complementary Watson and Crick strands at each position. For all oligonucleotides for a particular SNP, the number used to label the coordinate is the coordinate of the first base of the oligonucleotide in the 'F' orientation. In addition, the oligonucleotides for the YJM789-derived sequences were labeled with the same coordinate as the S288c-derived sequences. The sequence information for the YJM789 sequences was from SGD based on the paper by (Wei et al., 2007. PNAS 104:12825-12830).

Arrays of this design have barcodes that begin with 16027438 or 2527438.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.
 
Citation(s) 22267500
Submission date May 04, 2015
Last update date May 05, 2015
Contact name Thomas D Petes
E-mail(s) tom.petes@duke.edu
Phone 919 684-4986
Organization name Duke University School of Medicine
Department Molecular Genetics and Microbiology
Lab Petes
Street address 213 Research Drive
City Durham
State/province NC
ZIP/Postal code 27710
Country USA
 
Samples (223) GSM1674652, GSM1674653, GSM1674654, GSM1674655, GSM1674656, GSM1674657 
Series (3)
GSE68530 The transient inactivation of the master cell cycle phosphatase Cdc14 causes genomic instability in diploid cells of Saccharomyces cerevisiae.
GSE73334 Genome-wide alterations in yeast strains lacking RNase H1, RNase H2, or both RNase H1 and RNase H2
GSE76395 High-resolution mapping of homologous recombination events in rad3 hyper-recombination mutants
Relations
Alternative to GPL20144 (Probe Name Version)

Data table header descriptions
ID Agilent feature number
COL Column
ROW Row
SPOT_ID Spot identifier
CONTROL_TYPE Control type
ACCESSION_STRING strain
CHROMOSOMAL_LOCATION Chromosomal Location
SEQUENCE

Data table
ID COL ROW SPOT_ID CONTROL_TYPE ACCESSION_STRING CHROMOSOMAL_LOCATION SEQUENCE
1 264 398 DarkCorner pos
2 264 396 DarkCorner pos
3 264 394 DarkCorner pos
4 264 392 chr1:101460YR FALSE YJM789 chr1:101460-101484 AGATGGAGCATATATACATGTTTTT
5 264 390 chr12:815975SR FALSE s288c chr12:815975-815999 GCTCGCAACTATCTAGCTAAATTAA
6 264 388 chr10:122055YR FALSE YJM789 chr10:122055-122079 CCTTTAATATATACATTAGGACTGG
7 264 386 chr12:301166SR FALSE s288c chr12:301166-301190 GGATAAGCATGCACTAGAATATGTA
8 264 384 chr4:127843YF FALSE YJM789 chr4:127843-127867 ATTACTCAAGTTCACGTGTAATGCG
9 264 382 chr16:380791SR FALSE s288c chr16:380791-380815 ATCAAATGTTAAAGGAATGAACCAG
10 264 380 chr10:342462YF FALSE YJM789 chr10:342462-342486 CATTCCCTGCCCATATTTTAAGCAC
11 264 378 chr4:971858SR FALSE s288c chr4:971858-971882 GTGGTTAAAGATACTAAGCTTGTCG
12 264 376 chr16:647706SF FALSE s288c chr16:647706-647730 CAGGATCGAAAATTCAAAACAGCAT
13 264 374 chr13:880223SF FALSE s288c chr13:880223-880247 AAAACGCATAATGGAATGAAGACTT
14 264 372 chr12:1020126YR FALSE YJM789 chr12:1020126-1020150 ATGTGACGATTGGAGAGCAAATAAA
15 264 370 chr1:99918SF FALSE s288c chr1:99918-99942 ACCTTTACCTCAATAATCCCGTAAT
16 264 368 chr13:708656YF FALSE YJM789 chr13:708656-708680 AACCAAATTAACAATGTTGAAGATT
17 264 366 chr10:661351SF FALSE s288c chr10:661351-661375 TATTTGTGCCTGGATTGAAATTGAT
18 264 364 YF1254738 FALSE YJM789 chr4:1254738-1254762
19 264 362 chr12:960122YR FALSE YJM789 chr12:960122-960146 AGAAATGGTGGGTTTTGTAAATTTT
20 264 360 chr4:1058614SR FALSE s288c chr4:1058614-1058638 CTTTTTGACTGTGCTTTCAACTTTT

Total number of rows: 105072

Table truncated, full table size 8315 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL20143_Yeast_S-Y_SNP_v1_027438_D_GEO_20100225.txt.gz 1.7 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap