NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL21282 Query DataSets for GPL21282
Status Public on Mar 30, 2016
Title Phalanx Human OneArray Ver. 7 Release 1
Technology type spotted oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Phalanx Biotech Inc
Manufacture protocol See http://www.phalanxbiotech.com/ for updated protocols
 
 
Submission date Dec 24, 2015
Last update date Mar 10, 2017
Contact name Sagar S Damle
E-mail(s) sdamle@ionisph.com
Organization name Ionis Pharmaceuticals
Street address 2855 Gazelle Ct
City Carlsbad
State/province CA
ZIP/Postal code 92010
Country USA
 
Samples (223) GSM1981781, GSM1981782, GSM1981783, GSM1981784, GSM1981785, GSM1981786 
Series (31)
GSE76343 Gene expression profile in cells treated with different oligonucleotides
GSE86570 Human polar body transfer eliminates the transmission of inherited mitochondrial DNA variants [mRNA]
GSE86650 Human polar body transfer eliminates the transmission of inherited mitochondrial DNA variants

Data table header descriptions
ID
Group
ENTREZ_GENE_ID
GB_LIST GenBank Accession number(s)
RNA_nucleotide_gi
Protein_accession.version
ORF Gene symbol
description
Chromosome
Map_location
GO_id_function
GO_id_component
GO_id_process
GO_term_function
GO_term_component
GO_term_process
Ensembl_gene
Ensembl_transcript
Ensembl_protein
Unigene_cluster
Uniprot_id
SEQUENCE

Data table
ID Group ENTREZ_GENE_ID GB_LIST RNA_nucleotide_gi Protein_accession.version ORF description Chromosome Map_location GO_id_function GO_id_component GO_id_process GO_term_function GO_term_component GO_term_process Ensembl_gene Ensembl_transcript Ensembl_protein Unigene_cluster Uniprot_id SEQUENCE
PH_hs_0000002 1 1089 NM_001817 NP_001808.2 CEACAM4 Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 4 (CEACAM4) 19 19q13.2 NA GO:0006909 GO:0016020,GO:0005887 NA phagocytosis integral component of plasma membrane,membrane ENSG00000105352 ENST00000221954,ENST00000600925,ENST00000472081 ENSP00000221954,ENSP00000473018 AACTATTCAAGCCTATTATTGGCACAAGGGGAAAACGGCAGAAGGGAGCCCTCTCATTGC
PH_hs_0000003 1 4049 NM_000595 NM_001159740 NP_000586.2,NP_001153212.1 LTA Homo sapiens lymphotoxin alpha (LTA) 6 6p21.3 GO:0005102,GO:0005125,GO:0005164 GO:0001666,GO:0006959,GO:0048147,GO:0007584,GO:0006915,GO:0042493,GO:0060252,GO:0043065,GO:0050830,GO:0007165,GO:0002925,GO:0002876,GO:0007267,GO:0032729,GO:0032496,GO:0048535,GO:0044130 GO:0016020,GO:0005615 cytokine activity,tumor necrosis factor receptor binding,receptor binding humoral immune response,positive regulation of interferon-gamma production,response to hypoxia,positive regulation of humoral immune response mediated by circulating immunoglobulin,positive regulation of apoptotic process,response to lipopolysaccharide,apoptotic process,response to drug,lymph node development,signal transduction,negative regulation of fibroblast proliferation,negative regulation of growth of symbiont in host,cell-cell signaling,positive regulation of glial cell proliferation,response to nutrient,defense response to Gram-positive bacterium,positive regulation of chronic inflammatory response to antigenic stimulus extracellular space,membrane ENSG00000223919 ENST00000432632,ENST00000487391,ENST00000441939,ENST00000464821 ENSP00000416337,ENSP00000387924 GTGAGAGGGCATGCGCACAAGGCTGACCAAGAGAGAAAGAAGTAGGCATGAGGGATCACA
PH_hs_0000004 1 38 NM_000019 NP_000010.1 ACAT1 Homo sapiens acetyl-CoA acetyltransferase 1 (ACAT1) 11 11q22.3 GO:0050662,GO:0003985,GO:0042803,GO:0019899,GO:0046872 GO:0007420,GO:0009725,GO:0072229,GO:0051260,GO:0044281,GO:0034641,GO:0014070,GO:0001889,GO:0009083,GO:0042594,GO:0060612,GO:0044255,GO:0046952,GO:0046950,GO:0046951 GO:0005759,GO:0005743,GO:0070062,GO:0005739 enzyme binding,protein homodimerization activity,coenzyme binding,acetyl-CoA C-acetyltransferase activity,metal ion binding ketone body biosynthetic process,metanephric proximal convoluted tubule development,ketone body catabolic process,response to starvation,response to organic cyclic compound,liver development,cellular nitrogen compound metabolic process,cellular lipid metabolic process,adipose tissue development,protein homooligomerization,brain development,small molecule metabolic process,branched-chain amino acid catabolic process,cellular ketone body metabolic process,response to hormone mitochondrial inner membrane,mitochondrion,mitochondrial matrix,extracellular exosome ENSG00000075239 ENST00000265838,ENST00000524833,ENST00000299355,ENST00000531813,ENST00000531853,ENST00000527942,ENST00000526119,ENST00000528370,ENST00000534773,ENST00000532792,ENST00000533610,ENST00000533597 ENSP00000265838,ENSP00000299355,ENSP00000435965,ENSP00000433568,ENSP00000436096 CATGCTAATTCAGAAGCTGTAGACAACCTCTGCTATTTAAGGAGACAACCCTATGTGACC
PH_hs_0000005 1 5764 NM_002825 NP_002816.1 PTN Homo sapiens pleiotrophin (PTN) 7 7q33 GO:0035373,GO:0004864,GO:0008083,GO:0008201 GO:0030324,GO:0007612,GO:0021510,GO:0001889,GO:0060221,GO:2000347,GO:0043086,GO:0036120,GO:0030282,GO:0045837,GO:0007185,GO:0008284,GO:1990089,GO:0010811,GO:0014823,GO:0071456,GO:0010976,GO:0007399,GO:0060291,GO:0042493,GO:0071340,GO:0051781,GO:0071305,GO:0030902 GO:0048471,GO:0016020,GO:0005783,GO:0005615 growth factor activity,chondroitin sulfate proteoglycan binding,protein phosphatase inhibitor activity,heparin binding learning,lung development,cellular response to vitamin D,spinal cord development,hindbrain development,positive regulation of cell-substrate adhesion,transmembrane receptor protein tyrosine phosphatase signaling pathway,negative regulation of catalytic activity,positive regulation of neuron projection development,response to activity,positive regulation of hepatocyte proliferation,negative regulation of membrane potential,cellular response to hypoxia,skeletal muscle acetylcholine-gated channel clustering,liver development,retinal rod cell differentiation,response to drug,positive regulation of cell proliferation,long-term synaptic potentiation,bone mineralization,cellular response to platelet-derived growth factor stimulus,positive regulation of cell division,nervous system development,response to nerve growth factor extracellular space,perinuclear region of cytoplasm,endoplasmic reticulum,membrane ENSG00000105894 ENST00000348225,ENST00000393083 ENSP00000341170,ENSP00000376798 GCTGGATTAAAAGATGTCACCTGTGGAACATAAAAAGGACATCAGCAAACAGGATCAGTT
PH_hs_0000006 1 5724 NM_001164723 NM_001164722 NM_001164721 NM_000952 NP_001158195.1,NP_001158194.1,NP_001158193.1,NP_000943.1 PTAFR Homo sapiens platelet-activating factor receptor (PTAFR) 1 1p35-p34.3 GO:0004930,GO:0005543,GO:0045028,GO:0001875,GO:0001530,GO:0004992 GO:0006935,GO:0031663,GO:0001816,GO:0060333,GO:0048015,GO:0006954,GO:0006955,GO:0032959,GO:0007186,GO:0035589,GO:0019221 GO:0043231,GO:0016021,GO:0016020,GO:0005654,GO:0005887,GO:0005886 platelet activating factor receptor activity,G-protein coupled receptor activity,lipopolysaccharide binding,lipopolysaccharide receptor activity,phospholipid binding,G-protein coupled purinergic nucleotide receptor activity phosphatidylinositol-mediated signaling,lipopolysaccharide-mediated signaling pathway,inflammatory response,G-protein coupled purinergic nucleotide receptor signaling pathway,cytokine production,chemotaxis,G-protein coupled receptor signaling pathway,immune response,inositol trisphosphate biosynthetic process,interferon-gamma-mediated signaling pathway,cytokine-mediated signaling pathway integral component of plasma membrane,nucleoplasm,membrane,intracellular membrane-bounded organelle,integral component of membrane,plasma membrane ENSG00000169403 ENST00000373857,ENST00000305392,ENST00000539896 ENSP00000362965,ENSP00000301974,ENSP00000442658 TAAACCACCTAGTTCTCCCCGATGGGGCATCGGTCTAAAGCTTTGGGGGAGTGGGCGCAG
PH_hs_0000007 1 5277 NM_002641 NR_033836 NR_033835 NM_020473 NP_002632.1,-,-,NP_065206.3 PIGA Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class A (PIGA) X Xp22.1 GO:0017176,GO:0008194,GO:0005515 GO:0044267,GO:0009893,GO:0043687,GO:0006501,GO:0006506,GO:0016254 GO:0016021,GO:0016020,GO:0000506,GO:0005789 protein binding,phosphatidylinositol N-acetylglucosaminyltransferase activity,UDP-glycosyltransferase activity cellular protein metabolic process,positive regulation of metabolic process,C-terminal protein lipidation,post-translational protein modification,preassembly of GPI anchor in ER membrane,GPI anchor biosynthetic process endoplasmic reticulum membrane,glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex,integral component of membrane,membrane ENSG00000165195 ENST00000333590,ENST00000482148,ENST00000475746,ENST00000463173,ENST00000474662,ENST00000542278 ENSP00000369820,ENSP00000442653 GTCAGTTTGCACTGGTCGGTATATGGAAACACATTGCTCTACCCTGCTACTTAGTTGATT
PH_hs_0000008 1 5631 NM_001204402 NM_002764 NP_001191331.1,NP_002755.1 PRPS1 Homo sapiens phosphoribosyl pyrophosphate synthetase 1 (PRPS1) X Xq22.3 GO:0016301,GO:0005515,GO:0016208,GO:0030246,GO:0004749,GO:0019003,GO:0043531,GO:0000287,GO:0005524,GO:0042803 GO:0006221,GO:0005975,GO:0034418,GO:0007399,GO:0031100,GO:0016310,GO:0006167,GO:0044281,GO:0006015,GO:0006164,GO:0046101,GO:0006144 GO:0002189,GO:0005829 carbohydrate binding,magnesium ion binding,ADP binding,GDP binding,protein binding,kinase activity,ATP binding,AMP binding,ribose phosphate diphosphokinase activity,protein homodimerization activity pyrimidine nucleotide biosynthetic process,purine nucleotide biosynthetic process,AMP biosynthetic process,carbohydrate metabolic process,5-phosphoribose 1-diphosphate biosynthetic process,organ regeneration,urate biosynthetic process,hypoxanthine biosynthetic process,phosphorylation,small molecule metabolic process,purine nucleobase metabolic process,nervous system development cytosol,ribose phosphate diphosphokinase complex ENSG00000147224 ENST00000372435,ENST00000372419,ENST00000372418,ENST00000372428 ENSP00000361512,ENSP00000361496,ENSP00000361495,ENSP00000361505 TTTCTTTGTTGAGAACAACTAGCAACAAAGGCAACCCATGTGTGACCAGTTCTCCCCAAG
PH_hs_0000009 1 5782 NM_001131009 NM_001131008 NM_002835 NP_001124481.1,NP_001124480.1,NP_002826.3 PTPN12 Homo sapiens protein tyrosine phosphatase, non-receptor type 12 (PTPN12) 7 7q11.23 GO:0004726,GO:0017124,GO:0005515 GO:0035335,GO:0042246,GO:0006470 GO:0005737,GO:0002102,GO:0005829,GO:0005886,GO:0042995,GO:0030054 protein binding,non-membrane spanning protein tyrosine phosphatase activity,SH3 domain binding peptidyl-tyrosine dephosphorylation,tissue regeneration,protein dephosphorylation cell projection,cytosol,cytoplasm,podosome,cell junction,plasma membrane ENSG00000127947 ENST00000248594,ENST00000460731,ENST00000523952,ENST00000433369,ENST00000415482,ENST00000435495,ENST00000418110,ENST00000522115,ENST00000440186,ENST00000447995,ENST00000481154,ENST00000494248,ENST00000464313,ENST00000407343,ENST00000520947,ENST00000519553 ENSP00000248594,ENSP00000428735,ENSP00000404050,ENSP00000392429,ENSP00000397991,ENSP00000392526,ENSP00000430726,ENSP00000413449,ENSP00000397364,ENSP00000385079 GGGAGCTAGAAGACACTTTAAGTTATACTGGAAAATTCAGGTGCCACTGAAAGCCAGATT
PH_hs_0000010 1 6390 NM_003000 NP_002991.2 SDHB Homo sapiens succinate dehydrogenase complex, subunit B, iron sulfur (Ip) 1 1p36.1-p35 GO:0051538,GO:0051539,GO:0051537,GO:0008177,GO:0005515,GO:0048039,GO:0046872,GO:0009055 GO:0044237,GO:0006105,GO:0006099,GO:0009060,GO:0044281,GO:0022904 GO:0005743,GO:0005749,GO:0070062,GO:0005739 2 iron, 2 sulfur cluster binding,ubiquinone binding,protein binding,3 iron, 4 sulfur cluster binding,succinate dehydrogenase (ubiquinone) activity,electron carrier activity,4 iron, 4 sulfur cluster binding,metal ion binding small molecule metabolic process,aerobic respiration,cellular metabolic process,respiratory electron transport chain,tricarboxylic acid cycle,succinate metabolic process mitochondrial inner membrane,mitochondrion,mitochondrial respiratory chain complex II, succinate dehydrogenase complex (ubiquinone),extracellular exosome ENSG00000117118 ENST00000375499,ENST00000485092,ENST00000475049,ENST00000485515,ENST00000491274,ENST00000475506,ENST00000463045,ENST00000466613 ENSP00000364649,ENSP00000480482,ENSP00000481376 GGATTGACACCAACCTCAATAAGGTCTCAAAAATCTACCCTCTTCCACACATGTATGTGA
PH_hs_0000011 1 9173 NM_003856 NP_003847.2 IL1RL1 Homo sapiens interleukin 1 receptor-like 1 (IL1RL1) 2 2q12 GO:0002113,GO:0002114,GO:0005057,GO:0004908,GO:0005515,GO:0004896 GO:0008285,GO:0050729,GO:0002826,GO:0043032,GO:0090197,GO:0007165,GO:0038172,GO:0032689,GO:1901653,GO:0006955,GO:0043124,GO:0035556,GO:0032754 GO:0005615,GO:0009986,GO:0005578,GO:0005886,GO:0005622,GO:0016021 interleukin-1 receptor activity,protein binding,interleukin-33 binding,cytokine receptor activity,receptor signaling protein activity,interleukin-33 receptor activity interleukin-33-mediated signaling pathway,intracellular signal transduction,negative regulation of interferon-gamma production,negative regulation of T-helper 1 type immune response,cellular response to peptide,signal transduction,negative regulation of I-kappaB kinas,positive regulation of inflammatory response,positive regulation of interleukin-5 production,positive regulation of macrophage activation,positive regulation of chemokine secretion,immune response,negative regulation of cell proliferation extracellular space,intracellular,cell surface,proteinaceous extracellular matrix,integral component of membrane,plasma membrane ENSG00000115602 ENST00000233954,ENST00000473175,ENST00000447231,ENST00000311734,ENST00000463990,ENST00000409584,ENST00000482701,ENST00000427077,ENST00000404917 ENSP00000233954,ENSP00000409437,ENSP00000310371,ENSP00000386618,ENSP00000391120,ENSP00000384822 GCAGGGACATCATCTCTTCCATCTTTGGGTCCTTAGTGCAATACCTGGCAGCTAGCCAGT
PH_hs_0000012 1 3561 NM_000206 NP_000197.1 IL2RG Homo sapiens interleukin 2 receptor, gamma (IL2RG) X Xq13.1 GO:0004917,GO:0004911,GO:0019976,GO:0004913,GO:0019982,GO:0005515 GO:0035771,GO:0038111,GO:0038110,GO:0007165,GO:0016032,GO:0006955 GO:0009897,GO:0016020,GO:0005887,GO:0005886 contributes_to interleukin-2 receptor activity,contributes_to interleukin-7 receptor activity,interleukin-7 binding,protein binding,interleukin-2 binding,contributes_to interleukin-4 receptor activity interleukin-2-mediated signaling pathway,signal transduction,viral process,interleukin-4-mediated signaling pathway,interleukin-7-mediated signaling pathway,immune response integral component of plasma membrane,external side of plasma membrane,plasma membrane,membrane ENSG00000147168 ENST00000276110,ENST00000374202,ENST00000512747,ENST00000482750,ENST00000464642,ENST00000487883,ENST00000473378,ENST00000374188,ENST00000456850 ENSP00000363318,ENSP00000421262,ENSP00000425233,ENSP00000423966,ENSP00000423601,ENSP00000363303,ENSP00000388967 GAAGAACCCCAGGGTCCTGTAGCCCTAAGTGGTACTAACTTTCCTTCATTCAACCCACCT
PH_hs_0000013 1 5933 NM_002895 NP_002886.2 RBL1 Homo sapiens retinoblastoma-like 1 (RBL1) 20 20q11.2 GO:0008134,GO:0005515 GO:0043550,GO:0000278,GO:0051726,GO:0000122,GO:0007179,GO:0010467,GO:0045944,GO:0006351,GO:0006367,GO:0016032,GO:0016568 GO:0005654,GO:0005634,GO:0005667 protein binding,transcription factor binding mitotic cell cycle,negative regulation of transcription from RNA polymerase II promoter,chromatin modification,transcription initiation from RNA polymerase II promoter,transforming growth factor beta receptor signaling pathway,viral process,regulation of cell cycle,positive regulation of transcription from RNA polymerase II promoter,regulation of lipid kinase activity,gene expression,transcription, DNA-templated nucleoplasm,transcription factor complex,nucleus ENSG00000080839 ENST00000373664,ENST00000344359,ENST00000525052,ENST00000527999 ENSP00000362768,ENSP00000343646,ENSP00000434711,ENSP00000437240 ACACTCATCCTTGCTTTCCAGCCCTAAGCCATCTCAGCCTGATGTCACAACCCAATAAAT
PH_hs_0000014 1 275 NM_001164712 NM_001164711 NM_001164710 NM_000481 NR_028435 NP_001158184.1,NP_001158183.1,NP_001158182.1,NP_000472.2,- AMT Homo sapiens aminomethyltransferase (AMT) 3 3p21.31 GO:0004047,GO:0008483 GO:0006546,GO:0032259 GO:0005739 transaminase activity,aminomethyltransferase activity glycine catabolic process,methylation mitochondrion ENSG00000145020 ENST00000465925,ENST00000427987,ENST00000458307,ENST00000476226,ENST00000273588,ENST00000476127,ENST00000495436,ENST00000399379,ENST00000473163,ENST00000430521,ENST00000491800,ENST00000487589,ENST00000461210,ENST00000478594,ENST00000480957,ENST00000493046,ENST00000485108,ENST00000476828,ENST00000462048,ENST00000498571,ENST00000395338,ENST00000538581 ENSP00000403821,ENSP00000415619,ENSP00000273588,ENSP00000399943,ENSP00000388068,ENSP00000378747,ENSP00000443200 CCATGGTTTTTCACATTGCAAAGGGTAATAACATGGGCAGTGCGGACTTAGGCTACCCCC
PH_hs_0000015 1 3083 NM_001528 NP_001519.1 HGFAC Homo sapiens HGF activator (HGFAC) 4 4p16 GO:0004252,GO:0008236 GO:0006508 GO:0005576,GO:0005615 serine-type endopeptidase activity,serine-type peptidase activity proteolysis extracellular region,extracellular space ENSG00000109758 ENST00000382774,ENST00000511533,ENST00000509689,ENST00000506132 ENSP00000372224,ENSP00000421801 GTGACGCAGACCTTCGGCATCGAGAAGTACATCCCGTACACCCTGTACTCGGTGTTCAAC
PH_hs_0000016 1 2267 NM_201553 NM_201552 NM_147203 NM_004467 NP_963847.1,NP_963846.1,NP_671736.2,NP_004458.3 FGL1 Homo sapiens fibrinogen-like 1 (FGL1) 8 8p22 NA NA GO:0005577,GO:0070062 NA NA fibrinogen complex,extracellular exosome ENSG00000104760 ENST00000398056,ENST00000522444,ENST00000518650,ENST00000522636,ENST00000523097,ENST00000518769,ENST00000519055,ENST00000427924,ENST00000381841,ENST00000398054,ENST00000381840 ENSP00000381133,ENSP00000429757,ENSP00000428430,ENSP00000401952,ENSP00000371263,ENSP00000381131,ENSP00000371262 GGTGTATACTACAGCGGCCCCTACACGGCTAAAACAGACAATGGGATTGTCTGGTACACC
PH_hs_0000017 1 1800 NM_001128141 NM_004413 NP_001121613.1,NP_004404.1 DPEP1 Homo sapiens dipeptidase 1 (renal) 16 16q24.3 GO:0072341,GO:0008239,GO:0005515,GO:0070573,GO:0034235,GO:0008235,GO:0043027,GO:0008270 GO:0030336,GO:0072340,GO:0016999,GO:0006805,GO:0071732,GO:0043066,GO:0071277,GO:0006691,GO:0043154,GO:0035690,GO:0019369,GO:0044281,GO:0006749,GO:0006508,GO:0050667 GO:0031528,GO:0045177,GO:0005615,GO:0016324,GO:0005634,GO:0005886,GO:0031225,GO:0030054,GO:0070062 protein binding,metallodipeptidase activity,zinc ion binding,dipeptidyl-peptidase activity,GPI anchor binding,cysteine-type endopeptidase inhibitor activity involved in apoptotic process,metalloexopeptidase activity,modified amino acid binding antibiotic metabolic process,glutathione metabolic process,cellular response to nitric oxide,cellular lactam catabolic process,xenobiotic metabolic process,cellular response to drug,proteolysis,small molecule metabolic process,negative regulation of cysteine-type endopeptidase activity involved in apoptotic process,negative regulation of cell migration,homocysteine metabolic process,cellular response to calcium ion,leukotriene metabolic process,arachidonic acid metabolic process,negative regulation of apoptotic process extracellular space,apical part of cell,apical plasma membrane,microvillus membrane,nucleus,anchored component of membrane,cell junction,plasma membrane,extracellular exosome ENSG00000015413 ENST00000570029,ENST00000565249,ENST00000564281,ENST00000568281,ENST00000393092,ENST00000561484,ENST00000261615,ENST00000564645,ENST00000421184 ENSP00000455916,ENSP00000455142,ENSP00000376807,ENSP00000261615,ENSP00000397313 AGGACGTCTCCAAGTATCCAGACCTGATCGCTGAGCTGCTCAGGAGGAACTGGACGGAGG
PH_hs_0000018 1 9581 NM_001171617 NM_001171613 NM_001171606 NM_001171603 NM_001042386 NM_001042385 NM_006036 NP_001165088.1,NP_001165084.1,NP_001165077.1,NP_001165074.1,NP_001035845.1,NP_001035844.1,NP_006027.2 PREPL Homo sapiens prolyl endopeptidase-like (PREPL) 2 2p21 GO:0004252,GO:0070008 GO:0006508 GO:0005856,GO:0005794,GO:0005829 serine-type exopeptidase activity,serine-type endopeptidase activity proteolysis cytosol,cytoskeleton,Golgi apparatus ENSG00000138078 ENST00000425263,ENST00000426481,ENST00000409411,ENST00000409957,ENST00000409936,ENST00000444696,ENST00000260648,ENST00000409272,ENST00000410081,ENST00000378520,ENST00000378511,ENST00000420756,ENST00000540817,ENST00000438314,ENST00000477410,ENST00000541738 ENSP00000391456,ENSP00000409480,ENSP00000387095,ENSP00000387241,ENSP00000386543,ENSP00000390618,ENSP00000260648,ENSP00000386909,ENSP00000386509,ENSP00000367781,ENSP00000367772,ENSP00000395692,ENSP00000395034,ENSP00000439626 ATGAAAGCACATGTTTCAGTGCCACTCACATAAGAAGTGCCCGGTAAGTGTTAGCTATTA
PH_hs_0000019 1 2254 NM_002010 NP_002001.1 FGF9 Homo sapiens fibroblast growth factor 9 (FGF9) 13 13q11-q12 GO:0005104,GO:0008083,GO:0008201 GO:0030326,GO:0048566,GO:0090263,GO:0008584,GO:0048011,GO:0010628,GO:0021762,GO:0045880,GO:0001525,GO:0008543,GO:0030178,GO:0001649,GO:0000122,GO:0032927,GO:0048505,GO:0002062,GO:0008284,GO:0008286,GO:0048706,GO:0030238,GO:0045087,GO:0006606,GO:0043410,GO:0042472,GO:0007173,GO:0060484,GO:0048015,GO:0038095,GO:0050679,GO:0060045,GO:0030949,GO:0002053,GO:0051781,GO:0007267,GO:0001654,GO:0007165 GO:0005737,GO:0005615,GO:0005604,GO:0070062,GO:0005576 growth factor activity,fibroblast growth factor receptor binding,heparin binding male gonad development,fibroblast growth factor receptor signaling pathway,positive regulation of mesenchymal cell proliferation,positive regulation of epithelial cell proliferation,protein import into nucleus,Fc-epsilon receptor signaling pathway,cell-cell signaling,positive regulation of cell proliferation,positive regulation of vascular endothelial growth factor receptor signaling pathway,innate immune response,chondrocyte differentiation,embryonic skeletal system development,lung-associated mesenchyme development,epidermal growth factor receptor signaling pathway,negative regulation of Wnt signaling pathway,substantia nigra development,positive regulation of cardiac muscle cell proliferation,embryonic digestive tract development,negative regulation of transcription from RNA polymerase II promoter,positive regulation of smoothened signaling pathway,phosphatidylinositol-mediated signaling,positive regulation of MAPK cascade,eye development,embryonic limb morphogenesis,positive regulation of activin receptor signaling pathway,positive regulation of gene expression,inner ear morphogenesis,regulation of timing of cell differentiation,signal transduction,male sex determination,osteoblast differentiation,insulin receptor signaling pathway,positive regulation of canonical Wnt signaling pathway,angiogenesis,positive regulation of cell division,neurotrophin TRK receptor signaling pathway extracellular region,cytoplasm,basement membrane,extracellular space,extracellular exosome ENSG00000102678 ENST00000382353,ENST00000461657,ENST00000478546 ENSP00000371790 TGGTATAATACGTACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTAT
PH_hs_0000021 1 886 NM_000730 NP_000721.1 CCKAR Homo sapiens cholecystokinin A receptor (CCKAR) 4 4p15.2 GO:0004951,GO:0042277 GO:0007631,GO:0051384,GO:0030157,GO:0009314,GO:0031016,GO:0043266,GO:0001764,GO:0042594,GO:0001659,GO:0032496,GO:0030073,GO:0038188,GO:0031532,GO:0002023,GO:1901652,GO:0031100,GO:0007586,GO:0007584,GO:0090274,GO:0032870,GO:0046883,GO:0007409,GO:0009408,GO:0007200,GO:0051924,GO:0007204,GO:0030900,GO:0001696 GO:0043195,GO:0005783,GO:0005829,GO:0005764,GO:0005887,GO:0005886,GO:0005768 peptide binding,cholecystokinin receptor activity temperature homeostasis,pancreas development,feeding behavior,digestion,cellular response to hormone stimulus,forebrain development,response to lipopolysaccharide,response to heat,response to starvation,pancreatic juice secretion,response to peptide,axonogenesis,regulation of hormone secretion,response to nutrient,reduction of food intake in response to dietary excess,actin cytoskeleton reorganization,response to radiation,organ regeneration,positive regulation of somatostatin secretion,insulin secretion,gastric acid secretion,cholecystokinin signaling pathway,positive regulation of cytosolic calcium ion concentration,regulation of calcium ion transport,neuron migration,response to glucocorticoid,regulation of potassium ion transport,phospholipase C-activating G-protein coupled receptor signaling pathway endosome,terminal bouton,lysosome,cytosol,endoplasmic reticulum,integral component of plasma membrane,plasma membrane ENSG00000163394 ENST00000295589 ENSP00000295589 TGTCCAGGTTCTCGTACAGCCATATGAGTGCCTCGGTGCCACCCCAGTGAGATGTCCCCT
PH_hs_0000022 1 9586 NM_001011666 NM_004904 NM_182899 NM_182898 NP_001011666.1,NP_004895.2,NP_878902.2,NP_878901.2 CREB5 Homo sapiens cAMP responsive element binding protein 5 (CREB5) 7 7p15.1 GO:0003700,GO:0043565,GO:0046872,GO:0005515 GO:0045893,GO:0006366 GO:0005634,GO:0070062 protein binding,transcription factor activity, sequence-specific DNA binding,metal ion binding,sequence-specific DNA binding positive regulation of transcription, DNA-templated,transcription from RNA polymerase II promoter nucleus,extracellular exosome ENSG00000146592 ENST00000396299,ENST00000469531,ENST00000478078,ENST00000482692,ENST00000424599,ENST00000357727,ENST00000396300,ENST00000409603,ENST00000461921,ENST00000426500,ENST00000396298,ENST00000468391,ENST00000484383,ENST00000468813,ENST00000498316 ENSP00000379593,ENSP00000394088,ENSP00000350359,ENSP00000379594,ENSP00000387197,ENSP00000394979,ENSP00000379592,ENSP00000440429 CAGATCCAAGGTAACTGGGTAGGAAATCTTTTGACATCTTAACTCATGTTGAGTTTGTGC

Total number of rows: 28264

Table truncated, full table size 25477 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap