NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL21361 Query DataSets for GPL21361
Status Public on Jan 01, 2017
Title Agilent-049002 zebrav360k026437 026437 [Probe name version]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Danio rerio
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description D. rerio (Zebrafish) Oligo Microarray V3

Arrays of this design have barcodes that begin with 16049002 or 2549002.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

 
Submission date Jan 22, 2016
Last update date Jan 01, 2017
Contact name June-Woo Park
E-mail(s) jwpark@kitox.re.kr
Organization name Korea Institute of Toxicology
Department Environmental Risk Research
Street address 17, Jegok-gil, Munsan-eup
City Jinju
ZIP/Postal code 52834
Country South Korea
 
Samples (8) GSM2044847, GSM2044848, GSM2044849, GSM2044850, GSM2044851, GSM2044852 
Series (1)
GSE77148 Comparisons of toxicogenomic responses in zebrafish (Danio rerio) exposed to ZnO nanoparticles and ZnSO4: The impact of sublethal concentration (LC25) on global gene expression profiles

Data table header descriptions
ID Agilent Probe Name
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
LOCUSLINK_ID LocuslinkID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC LOCUSLINK_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
GE_BrightCorner GE_BrightCorner pos
DarkCorner DarkCorner pos
A_15_P578857 A_15_P578857 FALSE NM_001007447 NM_001007447 100005717 cpt2 carnitine palmitoyltransferase II Dr.75429 ENSDART00000146679 ref|NM_001007447|ens|ENSDART00000146679|ens|ENSDART00000143192|ens|ENSDART00000111009 chr8:21679170-21679111 Danio rerio carnitine palmitoyltransferase II (cpt2), nuclear gene encoding mitochondrial protein, mRNA [NM_001007447] GO:0004095(carnitine O-palmitoyltransferase activity)|GO:0005739(mitochondrion)|GO:0005743(mitochondrial inner membrane)|GO:0006629(lipid metabolic process)|GO:0006631(fatty acid metabolic process)|GO:0006810(transport)|GO:0016020(membrane)|GO:0016740(transferase activity)|GO:0016746(transferase activity, transferring acyl groups) TACTTGTCTGCTCGGGAGTCTATAGTGCTTAACTTTAACCCCTTCATGTCCTTTAACCCT
A_15_P663551 A_15_P663551 FALSE NM_001089502 NM_001089502 559251 zp2l2 zona pellucida glycoprotein 2, like 2 Dr.75678 ref|NM_001089502|gb|BC134168|tc|TC373389 unmapped Danio rerio zona pellucida glycoprotein 2, like 2 (zp2l2), mRNA [NM_001089502] GO:0005575(cellular_component) GTTTTAACACATCGGCTCAGACCTGCACCTCAACCTGTTCCAGTCTGAACATAATAAAAC
A_15_P724671 A_15_P724671 FALSE NM_001045846 NM_001045846 558275 cdc42ep1b CDC42 effector protein (Rho GTPase binding) 1b Dr.78877 ENSDART00000090221 ref|NM_001045846|ens|ENSDART00000090221|gb|BC122441|tc|TC407433 chr16:15627312-15627286 Danio rerio CDC42 effector protein (Rho GTPase binding) 1b (cdc42ep1b), mRNA [NM_001045846] GAGGACATTGCAAGCATTTTGAGGACCAAAAGAAGTGGATGGATCAAGTGAACTGAAGCA
A_15_P107039 A_15_P107039 FALSE NM_001004546 NM_001004546 447807 slc51a solute carrier family 51, alpha subunit Dr.27305 ENSDART00000066631 ref|NM_001004546|ens|ENSDART00000066631|gb|BC081597|tc|TC445195 chr24:25569960-25569901 Danio rerio solute carrier family 51, alpha subunit (slc51a), mRNA [NM_001004546] GO:0005215(transporter activity)|GO:0005783(endoplasmic reticulum)|GO:0005789(endoplasmic reticulum membrane)|GO:0005886(plasma membrane)|GO:0006810(transport)|GO:0015721(bile acid and bile salt transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0042803(protein homodimerization activity)|GO:0043234(protein complex)|GO:0046982(protein heterodimerization activity) GAGCTGGATAAAGGTCAGCATTCTTTCATGTTGCTAAATTGTACGTTCGTATAATATCCT
A_15_P115920 A_15_P115920 FALSE BC060912 326723 ppp4r2a protein phosphatase 4, regulatory subunit 2a Dr.76534 ENSDART00000035693 ens|ENSDART00000035693|gb|BC060912|tc|TC368293 chr23:10933436-10933495 protein phosphatase 4, regulatory subunit 2a [Source:ZFIN;Acc:ZDB-GENE-030131-4922] [ENSDART00000035693] TCAAGTGGGCAGGAGCTGGTATAAGTTTCTGATAACCTTAGATAAAAATATCACGATTAC
A_15_P310536 A_15_P310536 FALSE BC142902 567267 kcnv2a potassium channel, subfamily V, member 2a Dr.90066 ENSDART00000111073 ens|ENSDART00000111073|ens|ENSDART00000136239|gb|BC142902|tc|TC372942 chr10:15340236-15340295 potassium channel, subfamily V, member 2a [Source:ZFIN;Acc:ZDB-GENE-091117-27] [ENSDART00000111073] GO:0005216(ion channel activity)|GO:0005244(voltage-gated ion channel activity)|GO:0005249(voltage-gated potassium channel activity)|GO:0005251(delayed rectifier potassium channel activity)|GO:0005267(potassium channel activity)|GO:0006810(transport)|GO:0006811(ion transport)|GO:0006813(potassium ion transport)|GO:0008076(voltage-gated potassium channel complex)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0034765(regulation of ion transmembrane transport)|GO:0051260(protein homooligomerization)|GO:0055085(transmembrane transport)|GO:0071805(potassium ion transmembrane transport) TGAGTATGTCGAGACTTTCTGTATTGCATTTTTCACCATGGAATACCTGCTCCGGCTTGT
A_15_P182796 A_15_P182796 FALSE XM_001339251 XM_001339251 798868 LOC798868 cytoplasmic dynein 1 intermediate chain 1-like ENSDART00000039186 ens|ENSDART00000039186|tc|TC435588|ref|XM_001339251 Zv9_NA399:58193-76923 dynein, cytoplasmic 1, intermediate chain 1 [Source:HGNC Symbol;Acc:2963] [ENSDART00000039186] AAATTGTGGAGCACAAAGCAAAACAAGCCGCTGTACTCGTTTGAGGACAACGCAGACTAT
A_15_P113247 A_15_P113247 FALSE chr13:009926231-009926291 ATGATGTTATAAAATGGGCTTTTAAAAGGCTGTTTGTATGTAAAAACCCTGGTGTTGCTC
A_15_P758628 A_15_P758628 FALSE XM_001336150 XM_001336150 tc|TC377115|ref|XM_001336150|ref|XM_003200375|ref|XM_001334159 chr12:15132290-15132231 PREDICTED: Danio rerio hypothetical protein LOC795900 (LOC795900), mRNA [XM_001336150] GO:0000165(MAPK cascade)|GO:0001501(skeletal system development)|GO:0003878(ATP citrate synthase activity)|GO:0004616(phosphogluconate dehydrogenase (decarboxylating) activity)|GO:0004674(protein serine/threonine kinase activity)|GO:0005007(fibroblast growth factor-activated receptor activity)|GO:0005515(protein binding)|GO:0005575(cellular_component)|GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005764(lysosome)|GO:0005811(lipid particle)|GO:0005829(cytosol)|GO:0005887(integral to plasma membrane)|GO:0006085(acetyl-CoA biosynthetic process)|GO:0006098(pentose-phosphate shunt)|GO:0006101(citrate metabolic process)|GO:0007259(JAK-STAT cascade)|GO:0007267(cell-cell signaling)|GO:0008083(growth factor activity)|GO:0008150(biological_process)|GO:0008285(negative regulation of cell proliferation)|GO:0008543(fibroblast growth factor receptor signaling pathway)|GO:0009346(citrate lyase complex)|GO:0009898(internal side of plasma membrane)|GO:0016021(integral to membrane)|GO:0016049(cell growth)|GO:0016407(acetyltransferase activity)|GO:0018105(peptidyl-serine phosphorylation)|GO:0018107(peptidyl-threonine phosphorylation)|GO:0030900(forebrain development)|GO:0042802(identical protein binding)|GO:0043065(positive regulation of apoptotic process)|GO:0043410(positive regulation of MAPK cascade)|GO:0045597(positive regulation of cell differentiation)|GO:0048471(perinuclear region of cytoplasm)|GO:0050680(negative regulation of epithelial cell proliferation)|GO:0050731(positive regulation of peptidyl-tyrosine phosphorylation) TTATTATCAGACATGTCCCTGGCAAAGAAAACCTTACGGCTGACTACTTGTCCCGATGTG
A_15_P735496 A_15_P735496 FALSE tc|TC443097 chr8:35169718-35169659 Rep: GA17772-PA - Drosophila pseudoobscura (Fruit fly), partial (9%) [TC443097] GCACATTTTGTTTTCCTTCTGACAGTGTGTATAGGTTTAAATGGCAAAGATCGCTTTCAA
A_15_P156631 A_15_P156631 FALSE EH486366 100048920 thtpa thiamine triphosphatase Dr.87110 ENSDART00000091784 ens|ENSDART00000091784|gb|EH486366|tc|TC415130|tc|TC378768 chr24:14504322-14504381 thiamine triphosphatase [Source:ZFIN;Acc:ZDB-GENE-070502-2] [ENSDART00000091784] GO:0006772(thiamine metabolic process)|GO:0050333(thiamin-triphosphatase activity) GGCAACAAAAGGTATAGTTTGTGACATTATGATGTTTGTGGTTATTGCCAAATAAAGCAG
A_15_P168451 A_15_P168451 FALSE NM_001044319 NM_001044319 553232 znf296 zinc finger protein 296 Dr.79856 ENSDART00000098980 ref|NM_001044319|ens|ENSDART00000098980|gb|BC152534|gb|BC125905 chr18:34985992-34986051 Danio rerio zinc finger protein 296 (znf296), mRNA [NM_001044319] GO:0003676(nucleic acid binding)|GO:0005622(intracellular)|GO:0008270(zinc ion binding) TGTAGAGATTGTTCAGGACTGGCAACGGGAGAACGAAAGGAGGCAGGTCACCAATGGAAT
A_15_P402190 A_15_P402190 FALSE NM_001114883 NM_001114883 322909 cald1l caldesmon 1 like Dr.114623 ENSDART00000103048 ref|NM_001114883|ens|ENSDART00000103048|gb|BC158175|tc|TC371232 chr4:6546204-6549400 Danio rerio caldesmon 1 like (cald1l), mRNA [NM_001114883] GO:0003779(actin binding)|GO:0005516(calmodulin binding)|GO:0006936(muscle contraction)|GO:0017022(myosin binding) TCCTCCCAAACACAAGAAAGCCGAGAGGACTTTCAGCCGAGGCAGTTTGCGTTCTCCCGA
A_15_P633361 A_15_P633361 FALSE NM_001037402 NM_001037402 641324 ube2v1 ubiquitin-conjugating enzyme E2 variant 1 Dr.132817 ENSDART00000067117 ref|NM_001037402|ens|ENSDART00000067117|gb|BC107635|tc|TC451143 chr11:2403855-2406841 Danio rerio ubiquitin-conjugating enzyme E2 variant 1 (ube2v1), mRNA [NM_001037402] GO:0016881(acid-amino acid ligase activity)|GO:0035370(UBC13-UEV1A complex)|GO:0070534(protein K63-linked ubiquitination) TTTGTCCGTTTTGTGACGAAGATCAACTTGAATGGAGTGCATAACTCCAATGGTGTGGTG
A_15_P131441 A_15_P131441 FALSE NM_131310 NM_131310 30573 hsp90ab1 heat shock protein 90, alpha (cytosolic), class B member 1 Dr.35688 ENSDART00000130572 ref|NM_131310|ens|ENSDART00000130572|ens|ENSDART00000129014|ens|ENSDART00000020084 chr20:51534630-51534689 Danio rerio heat shock protein 90, alpha (cytosolic), class B member 1 (hsp90ab1), mRNA [NM_131310] GO:0000166(nucleotide binding)|GO:0005515(protein binding)|GO:0005524(ATP binding)|GO:0005737(cytoplasm)|GO:0006457(protein folding)|GO:0006950(response to stress)|GO:0007517(muscle organ development)|GO:0051082(unfolded protein binding) ATATGAAAGTTTGACAGATCCCACCAAACTGGACAGCGGCAAAGACCTGAAGATCGACAT
A_15_P102800 A_15_P102800 FALSE NM_001017849 NM_001017849 550547 kif3cb kinesin family member 3Cb Dr.90744 ENSDART00000128715 ref|NM_001017849|ens|ENSDART00000128715|tc|TC413426 chr17:37377902-37377843 Danio rerio kinesin family member 3Cb (kif3cb), mRNA [NM_001017849] TCCGACGAAGACCAACTTCTGTAGTGGGAAACAAGAGACCAGTTAGTATGTACGCTCAAA
A_15_P545572 A_15_P545572 FALSE tc|TC380476 chr3:6145519-6145460 Rep: DEAD (Asp-Glu-Ala-Asp) box polypeptide 39b - Danio rerio (Zebrafish) (Brachydanio rerio), partial (76%) [TC380476] GO:0000346(transcription export complex)|GO:0000398(nuclear mRNA splicing, via spliceosome)|GO:0000781(chromosome, telomeric region)|GO:0002119(nematode larval development)|GO:0003723(RNA binding)|GO:0004004(ATP-dependent RNA helicase activity)|GO:0004616(phosphogluconate dehydrogenase (decarboxylating) activity)|GO:0005515(protein binding)|GO:0005575(cellular_component)|GO:0005634(nucleus)|GO:0005681(spliceosomal complex)|GO:0006098(pentose-phosphate shunt)|GO:0006283(transcription-coupled nucleotide-excision repair)|GO:0006348(chromatin silencing at telomere)|GO:0006368(transcription elongation from RNA polymerase II promoter)|GO:0006406(mRNA export from nucleus)|GO:0007276(gamete generation)|GO:0008150(biological_process)|GO:0008340(determination of adult lifespan)|GO:0009792(embryo development ending in birth or egg hatching)|GO:0030104(water homeostasis)|GO:0040032(post-embryonic body morphogenesis) ATCGCCATCCACAGAGGAATGGCCCAGGAGGAGCGGTGCGTGCAGACTTATACTGATTAA
A_15_P511752 A_15_P511752 FALSE XM_686358 562995 depdc5 DEP domain containing 5 ENSDART00000147861 ens|ENSDART00000147861|ens|ENSDART00000111088|ens|ENSDART00000134059|tc|TC424271 chr10:16976518-16976577 DEP domain containing 5 [Source:ZFIN;Acc:ZDB-GENE-091204-356] [ENSDART00000147861] TGCTATTACCATGGCAACTTCTCCCTTAATGCTGCCTTTGAAATCAAGCTGCACTGGATG

Total number of rows: 43659

Table truncated, full table size 20199 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL21361_049002_D_GEO_20130423.txt.gz 8.5 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap