NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL21786 Query DataSets for GPL21786
Status Public on Apr 28, 2016
Title NimbleGen Arabidopsis thaliana Gene Expression 12x135K Array [100718_Athal_TAIR9_exp; PROBE_ID]
Technology type in situ oligonucleotide
Distribution commercial
Organism Arabidopsis thaliana
Manufacturer NimbleGen
Manufacture protocol See manufacturer's website at http://www.nimblegen.com/
 
Description DESIGN_ID: 535493
DESIGN_NAME: 100718_Athal_TAIR9_exp
 
Submission date Apr 28, 2016
Last update date Apr 28, 2016
Organization NimbleGen Systems, Inc.
E-mail(s) geo@ncbi.nlm.nih.gov
Phone 608-218-7600
URL http://www.nimblegen.com/
Street address 504 S. Rosa Road
City Madison
State/province WI
ZIP/Postal code 53719
Country USA
 
Samples (30) GSM2136469, GSM2136470, GSM2136471, GSM2136472, GSM2136473, GSM2136474 
Series (1)
GSE80749 Transcript data affected by natural variation or PME17 mutation in Arabidopsis thaliana, infested or not with the aphid Myzus persicae
Relations
Alternative to GPL13970 (SEQ_ID)

Data table header descriptions
ID PROBE_ID
SEQ_ID SEQ_ID column from .ngd file
ORF Locus tag
PROBE_SEQUENCE
PROBE_CLASS
PROBE_DESIGN_ID
CONTAINER
POSITION

Data table
ID SEQ_ID ORF PROBE_SEQUENCE PROBE_CLASS PROBE_DESIGN_ID CONTAINER POSITION
Athal9P00528549 AT4G15885_1 AT4G15885 ATGGCTAGCAGTCAGAACACAAGCGATACATCTTCAAGGCAGTATGAAACAACGGAGCCT experimental 535493_0003_0025 BLOCK1 1
Athal9P00225704 AT2G12870_1 AT2G12870 CACAATTATCAAGCCGACATGCCCCGAGATCGAGGGCGAGGCCACGGCCGAGGTAGTGGA experimental 535493_0003_0027 BLOCK1 1329
Athal9P00726103 AT5G51700_1 AT5G51700 CAATCATGAGACTGCATGTAGCCATCATCCAGGTCCTGCGGTCTTCCACGACAGACTGAG experimental 535493_0003_0029 BLOCK1 578
Athal9P00594699 AT4G39510_1 AT4G39510 ATGGCCAAGAGAACTTAGACAAGTTGGTCTACTTACATGCGGCGTTGTATGAATCAATGA experimental 535493_0003_0031 BLOCK1 1236
Athal9P00331195 AT3G03340_1 AT3G03340 ATGATCGCCACAGGCGTCACAACCGCTACTAGATCGATCGGTCTTGCTGTCTAACAGGGT experimental 535493_0003_0033 BLOCK1 1297
Athal9P00087025 AT1G33160_1 AT1G33160 GATAACCAAAGAGATCACGGGGTTGGCACCTAGCAGCAGGTGGTTGCACCACCTGAGAAG experimental 535493_0003_0035 BLOCK1 264
Athal9P00608406 AT5G05610_1 AT5G05610 GAAGACAGTGAGTGAATGAATGAGTGAGTCATCTTTCTCATTTTTCCTTATTTCTTTTTA experimental 535493_0003_0037 BLOCK1 878
Athal9P00725837 AT5G51600_1 AT5G51600 ACCCACTTGTTGCCAGTGTCAGACAGTGCTATAGATCAGACTATCGTGGCGATAGAATCT experimental 535493_0003_0039 BLOCK1 1273
Athal9P00233469 AT2G15590_1 AT2G15590 CCGCTCTTGATCTGTACTGCGCGGTTCATAGACAATACAGCAACCATTTGTCTCGGACGT experimental 535493_0003_0041 BLOCK1 246
Athal9P00139421 AT1G59790_1 AT1G59790 TCAAACAAGCTGACGACAAAACTACTAATCAACTACTAATTGAGCTACACAATAAGTTCA experimental 535493_0003_0045 BLOCK1 965
Athal9P00212855 AT2G06720_1 AT2G06720 GACTTCATGGCCTCTAAATCTTCGACAACCACAGAGTCTCTACCAGCTACTCCACAGAAT experimental 535493_0003_0047 BLOCK1 2395
Athal9P00494660 AT4G05310_1 AT4G05310 TTAGTGGACGTGATACACATTTTGCCTCGTCTTTTACTCGTGGCTCTAAAGTCACAATGC experimental 535493_0003_0049 BLOCK1 1166
Athal9P00505890 AT4G08262_1 AT4G08262 AAACCTCTTGAATCGATATATCACGGATAGTGGTAAGTGTCCACGGTGTGACGAAGATGA experimental 535493_0003_0051 BLOCK1 4688
Athal9P00329761 AT3G02750_3 AT3G02750 GATCTTAAGCCAAATCTCCCAGGTTGGATTATCTTATGTGAATGTATGATGTTGTCCTGT experimental 535493_0003_0053 BLOCK1 1070
Athal9P00730050 AT5G53170_1 AT5G53170 TGGTCATGCTATTGTCGCTTTAAATACGAAAGGTGCGCACCCGATCCACAAAGCGACTAT experimental 535493_0003_0055 BLOCK1 1956
Athal9P00445096 AT3G51650_1 AT3G51650 TGACTTCGTGGCTATGAAATCTGTCCCTAATGAAGAGGAGAGGAACACTAATAATCCAGT experimental 535493_0003_0057 BLOCK1 1371
Athal9P00448026 AT3G52670_1 AT3G52670 TTTGCTCGACATTTGCGTGAATTGGTACTCTATGTTGCCCCGAAGCAGACCTTCACATTT experimental 535493_0003_0059 BLOCK1 220
Athal9P00484040 AT4G01975_1 AT4G01975 AATGAAATAGAGTGCCATGTCGCCATGTCTTACGTATCATCATAGATAATAAGCTTAATT experimental 535493_0003_0061 BLOCK1 2415
Athal9P00592105 AT4G38530_1 AT4G38530 CCAGAGAAGCCTATACGGGTCAGCATGGACGAGCAGTGGCTAGACACTATGGTTAGGACC experimental 535493_0003_0063 BLOCK1 986
Athal9P00504994 AT4G08101_1 AT4G08101 GCTTTTGACATGGATAAGCCGAGGAAGCCGCTTATGATTGACGACCAAGCATTCTCTATA experimental 535493_0003_0065 BLOCK1 825

Total number of rows: 137592

Table truncated, full table size 18836 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL21786_100718_Athal_TAIR9_exp.ndf.gz 7.8 Mb (ftp)(http) NDF

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap