NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL22080 Query DataSets for GPL22080
Status Public on Jan 01, 2017
Title NimbleGen Treponema denticola Array [2006-07-27_TI243275_60mer; PROBE_DESIGN_ID version]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Treponema denticola
Manufacturer NimbleGen
Manufacture protocol http://www.nimblegen.com/
 
Description designname=TI243275_analysis data
designid=4396
native array description file: TI243275_analysis data.ndf
Treponema denticola ATCC 35405, complete genome.
 
Submission date Jun 24, 2016
Last update date Jan 01, 2017
Contact name Kazuyuki Ishihara
Organization name Tokyo Dental College
Department Microbiolgy
Street address Misakicho 2-1-14
City Chiyoda-ku
State/province Tokyo
ZIP/Postal code 101-0061
Country Japan
 
Samples (2) GSM2203113, GSM2203114
Series (1)
GSE83445 Characterization of a potential ABC-type bacteriocin exporter protein from Treponema denticola

Data table header descriptions
ID PROBE_DESIGN_ID
SEQ_ID
CONTAINER
DESIGN_NOTE
SELECTION_CRITERIA
SEQUENCE PROBE_SEQUENCE
MISMATCH
MATCH_INDEX
FEATURE_ID
PROBE_CLASS
PROBE_ID from .ndf file
POSITION
ORF ORF Name
SECONDARY_NAME
ACCESSION
GI
FUNCTION
CHROMOSOME
MAPLOC
DESCRIPTION

Data table
ID SEQ_ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQUENCE MISMATCH MATCH_INDEX FEATURE_ID PROBE_CLASS PROBE_ID POSITION ORF SECONDARY_NAME ACCESSION GI FUNCTION CHROMOSOME MAPLOC DESCRIPTION
4396_0447_0039 TI243275S000001 BLOCK1 rank_selected rank:03;score:415;uniq:27;count:37;freq:00;rules:1;tm:80.4 TCGGAGGCAGGGACCACACGACCATCTTGCACGGTTGTAACAAGATTGAAGAGCAAATTG 0 72011668 72011668 experimental TI243275P00000007 1280 TDE0001 GI:42525520;GeneID:2741619 NC_002967 42516522 chromosomal replication initiator protein DnaA NC_002967 166-1575 identified by match to protein family HMM PF00308; match to protein family HMM TIGR00362
4396_0523_0123 TI243275S000001 BLOCK2 rank_selected rank:09;score:369;uniq:19;count:37;freq:00;rules:1;tm:80.4 GACCACACGACCATCTTGCACGGTTGTAACAAGATTGAAGAGCAAATTGCTGCCGACCCA 0 72171005 72171005 experimental TI243275P00000012 1291 TDE0001 GI:42525520;GeneID:2741619 NC_002967 42516522 chromosomal replication initiator protein DnaA NC_002967 166-1575 identified by match to protein family HMM PF00308; match to protein family HMM TIGR00362
4396_0701_0029 TI243275S000001 BLOCK3 rank_selected rank:01;score:610;uniq:32;count:37;freq:00;rules:1;tm:81.8 CGACTTCGGAGGCAGGGACCACACGACCATCTTGCACGGTTGTAACAAGATTGAAGAGCA 0 72342223 72342223 experimental TI243275P00000005 1275 TDE0001 GI:42525520;GeneID:2741619 NC_002967 42516522 chromosomal replication initiator protein DnaA NC_002967 166-1575 identified by match to protein family HMM PF00308; match to protein family HMM TIGR00362
4396_0709_0043 TI243275S000001 BLOCK4 rank_selected rank:08;score:375;uniq:25;count:37;freq:00;rules:1;tm:80.4 GGAGGCAGGGACCACACGACCATCTTGCACGGTTGTAACAAGATTGAAGAGCAAATTGCT 0 72456705 72456705 experimental TI243275P00000009 1282 TDE0001 GI:42525520;GeneID:2741619 NC_002967 42516522 chromosomal replication initiator protein DnaA NC_002967 166-1575 identified by match to protein family HMM PF00308; match to protein family HMM TIGR00362
4396_0219_0049 TI243275S000001 BLOCK5 rank_selected rank:10;score:365;uniq:27;count:37;freq:00;rules:1;tm:79.7 ACCGAGGGAGGAAGGGGACAGCATCCCGATTTGAGACCTGAGTATAATTTTGAGGA 0 72544566 72544566 experimental TI243275P00000001 358 TDE0001 GI:42525520;GeneID:2741619 NC_002967 42516522 chromosomal replication initiator protein DnaA NC_002967 166-1575 identified by match to protein family HMM PF00308; match to protein family HMM TIGR00362
4396_0023_0037 TI243275S000002 BLOCK1 rank_selected rank:03;score:570;uniq:29;count:37;freq:00;rules:1;tm:81.8 ATGATGAGGGTTACCCTTCCGGATGCCGTCGAAGCCGACAGAATTTTCAGCACGCTGATG 0 72007962 72007962 experimental TI243275P00000025 1789 TDE0002 GI:42525521;GeneID:2741616 NC_002967 42516522 "DNA gyrase, B subunit" NC_002967 1684-3600 identified by match to protein family HMM PF00204; match to protein family HMM PF00986; match to protein family HMM PF01751; match to protein family HMM PF02518; match to protein family HMM TIGR01059
4396_0745_0001 TI243275S000002 BLOCK2 rank_selected rank:08;score:458;uniq:34;count:37;freq:00;rules:1;tm:83.1 GAAAAATGTGTCGCTGAGGCCGCCGCCCGAATTGCTGCCAGAAGAGCAAAGGAAGCTACC 0 72172978 72172978 experimental TI243275P00000019 1132 TDE0002 GI:42525521;GeneID:2741616 NC_002967 42516522 "DNA gyrase, B subunit" NC_002967 1684-3600 identified by match to protein family HMM PF00204; match to protein family HMM PF00986; match to protein family HMM PF01751; match to protein family HMM PF02518; match to protein family HMM TIGR01059
4396_0575_0129 TI243275S000002 BLOCK3 rank_selected rank:11;score:436;uniq:25;count:37;freq:00;rules:1;tm:82.4 TCCGGATGCCGTCGAAGCCGACAGAATTTTCAGCACGCTGATGGGAGAAGAAGTCGAACC 0 72349169 72349169 experimental TI243275P00000026 1806 TDE0002 GI:42525521;GeneID:2741616 NC_002967 42516522 "DNA gyrase, B subunit" NC_002967 1684-3600 identified by match to protein family HMM PF00204; match to protein family HMM PF00986; match to protein family HMM PF01751; match to protein family HMM PF02518; match to protein family HMM TIGR01059
4396_0713_0117 TI243275S000002 BLOCK4 rank_selected rank:05;score:490;uniq:22;count:37;freq:00;rules:1;tm:81.1 GCTATCACAAGGTTATAATAATGGCCGATGCCGACGTTGACGGCTCCCATATCCGGACTC 0 72457369 72457369 experimental TI243275P00000023 1478 TDE0002 GI:42525521;GeneID:2741616 NC_002967 42516522 "DNA gyrase, B subunit" NC_002967 1684-3600 identified by match to protein family HMM PF00204; match to protein family HMM PF00986; match to protein family HMM PF01751; match to protein family HMM PF02518; match to protein family HMM TIGR01059
4396_0587_0099 TI243275S000002 BLOCK5 rank_selected rank:04;score:550;uniq:33;count:37;freq:00;rules:1;tm:81.8 AAAGACCCGGAGTCTTGCGAAGTTTACATAGTTGAGGGAGACTCTGCAGGCGGCTCTGCA 0 72534802 72534802 experimental TI243275P00000021 1252 TDE0002 GI:42525521;GeneID:2741616 NC_002967 42516522 "DNA gyrase, B subunit" NC_002967 1684-3600 identified by match to protein family HMM PF00204; match to protein family HMM PF00986; match to protein family HMM PF01751; match to protein family HMM PF02518; match to protein family HMM TIGR01059
4396_0751_0107 TI243275S000003 BLOCK1 rank_selected rank:03;score:450;uniq:16;count:33;freq:00;rules:1;tm:76.0 TAAGCCTTTTGGGAGGGATGGCTTTTTCCATTCCGATTACCATGTTGATAGCTTAA 0 71983504 71983504 experimental TI243275P00000039 665 TDE0003 GI:42525522;GeneID:2741617 NC_002967 42516522 hypothetical protein NC_002967 3623-4342 NA
4396_0427_0187 TI243275S000003 BLOCK2 rank_selected rank:03;score:450;uniq:16;count:33;freq:00;rules:1;tm:76.0 TAAGCCTTTTGGGAGGGATGGCTTTTTCCATTCCGATTACCATGTTGATAGCTTAA 0 72177042 72177042 experimental TI243275P00000039 665 TDE0003 GI:42525522;GeneID:2741617 NC_002967 42516522 hypothetical protein NC_002967 3623-4342 NA
4396_0049_0167 TI243275S000003 BLOCK3 rank_selected rank:05;score:439;uniq:24;count:37;freq:00;rules:1;tm:83.1 TGCCTTGGCTCCGCCTTTCGGTACTGGGAGCCTTAACCTATGAGCTTACTGCGGCAAGCA 0 72342837 72342837 experimental TI243275P00000027 233 TDE0003 GI:42525522;GeneID:2741617 NC_002967 42516522 hypothetical protein NC_002967 3623-4342 NA
4396_0675_0089 TI243275S000003 BLOCK4 rank_selected rank:05;score:439;uniq:24;count:37;freq:00;rules:1;tm:83.1 TGCCTTGGCTCCGCCTTTCGGTACTGGGAGCCTTAACCTATGAGCTTACTGCGGCAAGCA 0 72464433 72464433 experimental TI243275P00000027 233 TDE0003 GI:42525522;GeneID:2741617 NC_002967 42516522 hypothetical protein NC_002967 3623-4342 NA
4396_0633_0029 TI243275S000003 BLOCK5 rank_selected rank:03;score:450;uniq:16;count:33;freq:00;rules:1;tm:76.0 TAAGCCTTTTGGGAGGGATGGCTTTTTCCATTCCGATTACCATGTTGATAGCTTAA 0 72541830 72541830 experimental TI243275P00000039 665 TDE0003 GI:42525522;GeneID:2741617 NC_002967 42516522 hypothetical protein NC_002967 3623-4342 NA
4396_0393_0069 TI243275S000004 BLOCK1 rank_selected rank:02;score:457;uniq:18;count:28;freq:00;rules:1;tm:71.8 TTTTACCTGTATTTACTATAACACTTGGCCCAATTTTTGGCTCCTTTTAAG 0 71980628 71980628 experimental TI243275P00000041 105 TDE0004 GI:42525523;GeneID:2741618 NC_002967 42516522 hypothetical protein NC_002967 4383-5057 NA
4396_0315_0043 TI243275S000004 BLOCK2 rank_selected rank:02;score:457;uniq:18;count:28;freq:00;rules:1;tm:71.8 TTTTACCTGTATTTACTATAACACTTGGCCCAATTTTTGGCTCCTTTTAAG 0 72174166 72174166 experimental TI243275P00000041 105 TDE0004 GI:42525523;GeneID:2741618 NC_002967 42516522 hypothetical protein NC_002967 4383-5057 NA
4396_0593_0109 TI243275S000004 BLOCK3 rank_selected rank:07;score:383;uniq:29;count:37;freq:00;rules:1;tm:77.0 GTATGCTAATTCCCGTCGGGGCCGCAATTACAATCATCTACACAAGGATAATGTATAAGA 0 72330825 72330825 experimental TI243275P00000051 602 TDE0004 GI:42525523;GeneID:2741618 NC_002967 42516522 hypothetical protein NC_002967 4383-5057 NA
4396_0473_0021 TI243275S000004 BLOCK4 rank_selected rank:07;score:383;uniq:29;count:37;freq:00;rules:1;tm:77.0 GTATGCTAATTCCCGTCGGGGCCGCAATTACAATCATCTACACAAGGATAATGTATAAGA 0 72452421 72452421 experimental TI243275P00000051 602 TDE0004 GI:42525523;GeneID:2741618 NC_002967 42516522 hypothetical protein NC_002967 4383-5057 NA
4396_0381_0043 TI243275S000004 BLOCK5 rank_selected rank:08;score:371;uniq:21;count:37;freq:00;rules:0;tm:77.7 TGCTGATTCTTTTTATTGCAATGCCCCAGCTTGGAAAGGCCATAAGTATGCTAATTCCCG 0 72564032 72564032 experimental TI243275P00000046 557 TDE0004 GI:42525523;GeneID:2741618 NC_002967 42516522 hypothetical protein NC_002967 4383-5057 NA

Total number of rows: 13835

Table truncated, full table size 5312 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL22080_2006-07-27_TI243275_60mer.ndf.gz 10.4 Mb (ftp)(http) NDF
GPL22080_2006-07-27_TI243275_60mer.ngd.gz 121.6 Kb (ftp)(http) NGD
GPL22080_TI243275_PROBE_DESIGN_ID_analysis_data.ndf.gz 555.0 Kb (ftp)(http) NDF

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap