NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL23081 Query DataSets for GPL23081
Status Public on Feb 21, 2017
Title 20060419MD_PMC
Technology type spotted oligonucleotide
Distribution non-commercial
Organisms Saccharomyces bayanus; Saccharomyces cerevisiae
Manufacturer Lewis-Sigler Institute Microarray Facility
Manufacture protocol The following parameters were used to manufacture the printed array named "20060419MD_PMC"
Printer: Arrayer 250A
Array Configuration: (columns X rows) 48 sectors ( 4 X 12 spotted) Standard 48 tip
Spot Columns per Sector: 24
Spot Rows per Sector: 22
Column Spacing: 184
Row Spacing: 155
Plate Orientation: rotated 90 degrees clockwise (P1 top-left, A1 top-right)
Printhead Dip Dynamics: top to bottom, right to left
Sector Spotting Dynamics: left to right, top to bottom
Number of Slides: 240
Plates used in this print, in order.
PLATEID PLATENAME PLATE_VISITS IS_FLIPPED
100514 HYBRIDSC_2
100517 HYBRIDSC_5
100525 HYBRIDSC_13
100515 HYBRIDSC_3
100528 HYBRIDSC_16
100523 HYBRIDSC_11
100521 HYBRIDSC_9
100519 HYBRIDSC_7
100524 HYBRIDSC_12
100527 HYBRIDSC_15
100520 HYBRIDSC_8
100516 HYBRIDSC_4
100522 HYBRIDSC_10
100513 HYBRIDSC_1
100526 HYBRIDSC_14
100518 HYBRIDSC_6
100529 HYBRIDSC_17
100504 HYBRIDSB_5
100512 HYBRIDSB_13
100506 HYBRIDSB_7
100510 HYBRIDSB_11
100502 HYBRIDSB_3
100509 HYBRIDSB_10
100501 HYBRIDSB_2
100503 HYBRIDSB_4
100507 HYBRIDSB_8
100511 HYBRIDSB_12
100500 HYBRIDSB_1
100508 HYBRIDSB_9
100505 HYBRIDSB_6
37369 EMPTY_SC_1
37369 EMPTY_SC_1
37369 EMPTY_SC_1
37369 EMPTY_SC_1
37369 EMPTY_SC_1
37369 EMPTY_SC_1
100520 HYBRIDSC_8 1
100527 HYBRIDSC_15 1
100524 HYBRIDSC_12 1
100521 HYBRIDSC_9 1
100519 HYBRIDSC_7 1
100523 HYBRIDSC_11 1
100517 HYBRIDSC_5 1
100528 HYBRIDSC_16 1
100525 HYBRIDSC_13 1
100515 HYBRIDSC_3 1
100514 HYBRIDSC_2 1
100529 HYBRIDSC_17 1
100518 HYBRIDSC_6 1
100526 HYBRIDSC_14 1
100522 HYBRIDSC_10 1
100513 HYBRIDSC_1 1
100516 HYBRIDSC_4 1
100508 HYBRIDSB_9 1
100500 HYBRIDSB_1 1
100501 HYBRIDSB_2 1
100505 HYBRIDSB_6 1
100507 HYBRIDSB_8 1
100511 HYBRIDSB_12 1
100509 HYBRIDSB_10 1
100502 HYBRIDSB_3 1
100510 HYBRIDSB_11 1
100503 HYBRIDSB_4 1
100506 HYBRIDSB_7 1
100504 HYBRIDSB_5 1
100512 HYBRIDSB_13 1
 
Description Dunham project-SCSB-1-print 3, a multi-organism print. Printed in orange packing mode #3. Gal file must be ammended post download. Slides need to be crosslinked at ~70 mJ before use.
 
Submission date Feb 20, 2017
Last update date Feb 21, 2017
Contact name Maitreya J. Dunham
E-mail(s) maitreya@uw.edu
Phone 206-543-2338
Organization name University of Washington
Department Genome Sciences
Lab Dunham Lab
Street address Foege Building, S403B, Box 355065
City Seattle
State/province WA
ZIP/Postal code 98195-5065
Country USA
 
Samples (14) GSM2495992, GSM2495993, GSM2495997, GSM2496000, GSM2496001, GSM2496002 
Series (1)
GSE95086 Loss of heterozygosity drives adaptation in hybrid yeast

Data table header descriptions
ID feature/spot number
SPOT_ID clone identifier or gene name
ORGANISM the organism of the spotted sequence
ORF ORF Name
GENE_NAME the published name or descripion of the gene product
SEQUENCE oligonucleotide sequence
Sbayanus_ORF

Data table
ID SPOT_ID ORGANISM ORF GENE_NAME SEQUENCE Sbayanus_ORF
1 Saccharomyces cerevisiae YDR432W NPL3 GGGAAAATAGTTTAGAAACTACTTTTTCTAGCGTCAATACCAGAGATTTTGATGGTACCGGTGCTCTAGA
2 Saccharomyces cerevisiae YMR029C FAR8 TTTGTTTAGCACAGCCAACAAGCGTGAAAATAATGAAACAATATCCAAGATACACTCGGAATTGTCGAAA
3 Saccharomyces cerevisiae YER144C UBP5 TACCCTTATACTATTCAGATTTGCCCATTATACCGCAACCAAGCCCCAACAGAAATTCTCCCACCGTTCA
4 Saccharomyces cerevisiae YNR020C ATP23 TAAGAGTTCTAATATCAAAATGATCAGAAGAGTAAGGCATAATTTGTACAACCAAAACCAAGGAAAGCTG
5 Saccharomyces cerevisiae YKL123W AATAACAACGATGAGAACGCTGGTTGCAATGAAAATTCGCCATTATTGGAAGATGATGGCAATAAAAGAC
6 Saccharomyces cerevisiae YDR199W CTTTTTTTCTTCTCTTGAATCATTTTGTTTTACTTTAGCGTTATTGTCATTGTTAATACCACCATTAAAA
7 Saccharomyces cerevisiae YKL162C-A TTGTCTATCACACCAGAAGGGGATCTGCCCCTTAGTGGCCAAGATATCTTTTATCAATACTCGTTCAGCA
8 Saccharomyces cerevisiae YDR063W AIM7 AGCGAATTAGCCGAGATCCTACCTGATAACTCACCTAGATTTGTACTAACTGCATATCCAACAACAACAA
9 Saccharomyces cerevisiae YOL077W-A ATP19 AAAACAGTCGACATCAAAACAGACAACAAAGACGAGGAAAAATTCATTGAAAACTACTTAAAGAAACATT
10 Saccharomyces cerevisiae YOR330C MIP1 GTCCCCAGTTGTAAATTCCCTAATGAGTTCCAGTCTTTGTCCGCAAAATCGTCGTTAAATAATGAGAAGA
11 Saccharomyces cerevisiae YKL182W FAS1 TATTTTGAAGTTGTTGAAGGAGAACATAATCCAAATGGAAATGATTGAGAACAGAACTATGGATGGTAAG
12 Saccharomyces cerevisiae YKR092C SRP40 TTCCGACTCAAGCTCGGACTCAGACTCTTCAGGCTCGTCCGATTCTTCAAGCTCGTCTGATTCAAGTTCC
13 Saccharomyces cerevisiae YCR016W GTGAAAAAGACGGTAATGCCGAACAAGGGAAGCAAAAAGAGGTACAAGACGAGCAAGAGGAAGTACAAAT
14 Saccharomyces cerevisiae YGR170W PSD2 CCCCAGTAGACCAAGGACAACCACTGCAAATACATCTTCATCGACACTGTCAAATTCAGGGCTAAGTTCT
15 Saccharomyces cerevisiae YFL051C ACAATAGGCGACCAAACCACATACTTGGAGCCTGAATATATGGGCTATGAATACTCCAATACAAAGAAGT
16 Saccharomyces cerevisiae YHR092C HXT4 CTACGTTGAAATTCCAAAGAAGCCCGCCTCCGCCTACGTTACAGTTTCCATCTGTTGTTTAATGGTTGCT
17 Saccharomyces cerevisiae YGR203W YCH1 ACTCAATAACAAACGTAAAATACCTGGATCCGACTGAATTGCATCGTTGGATGCAAGAAGGACACACTAC
18 Saccharomyces cerevisiae YOR293C-A AAATTACTATTTCTGAATATTATAGTCGTGCGCCGCCATTTGCATTGTAAAAGCTACAGACTATCACCAT
19 Saccharomyces cerevisiae YDR405W MRP20 CCTCAGTGGTGGAGAGTTCCTCCAAAATACTCGACAAAAGCGGCAGCGATCGCGAAGTAGATATAAACGT
20 Saccharomyces cerevisiae YBL075C SSA3 AAGAGAAAGTAGGTGAAGATGATGCAAAGAGATTAGAAACAGCGTCTCAGGAAACCATTGACTGGTTAGA

Total number of rows: 25344

Table truncated, full table size 2573 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap