NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL23947 Query DataSets for GPL23947
Status Public on Aug 23, 2018
Title Duke/RG_AA_T7Primase_v1
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism synthetic construct
Manufacturer Agilent Technologies
Manufacture protocol Agilent Technologies
 
 
Submission date Aug 23, 2017
Last update date Aug 23, 2018
Contact name Raluca Gordan
E-mail(s) raluca.gordan@duke.edu
Organization name Duke University
Department Center for Genomic and Computational Biology
Street address 101 Science Dr, CIEMAS 2179
City Durham
State/province NC
ZIP/Postal code 27708
Country USA
 
Samples (1) GSM2752104
Series (1)
GSE102981 Sequence context controls the DNA binding and processivity of the T7 DNA primase

Data table header descriptions
ID Probe name
SEQUENCE Probe sequence

Data table
ID SEQUENCE
T7_00001_G01 CCAAAAAAAACCAACCCGTCAAAACCCCACAACCCC
T7_00002_G01 CAAAAAACCCCAAACCCGTCCAAAAACCCCAAACCC
T7_00003_G01 AACCCCACCCCAAAACCGTCCACCCCAAAAAAAAAC
T7_00004_G01 AAACCCCACCCAAAACCGTCCACCCCAAAACCAAAA
T7_00005_G01 AAACCCAAAAAAAAACCGTCCCAACCACCCAACCCC
T7_00006_G01 CCAACCCCAACCCAAAAGTCACCCACAAAAAAACCC
T7_00007_G01 CCCACCCCAAAAAAAAAGTCACCCACCACCCCAAAA
T7_00008_G01 ACCCACCCCAAACCAAAGTCAAAAACCCAAACCACC
T7_00009_G01 CAAAAAACCAAAACCCCGTCAACCCCAACCCCAAAC
T7_00010_G01 CACCCAAAACCCCAAAAGTCAACCCCACAACCCAAA
T7_00011_G01 CCAAAAAAAAAACCCCAGTCAACCCCAACCCAACCC
T7_00012_G01 ACAAAAAACCCACCCAAGTCAAACACCCCAAACCCC
T7_00013_G01 CCACCCAAAAAAAAACCGTCACCCCAAACCAAACCC
T7_00014_G01 CCCAAAAAAAAACCACCGTCCCAACCCAAACCCCAA
T7_00015_G01 AAAAAAAAACACCCCAAGTCCACCCAAACCCCACCC
T7_00016_G01 AAAACCCCAAAACCCAAGTCCCCAAACCACCCAAAC
T7_00017_G01 AACCAACACCCAAAAACGTCCCAACCAACCCACCAA
T7_00018_G01 ACCCCACCAAAAAAACCGTCAAAAAACCCCAACCCC
T7_00019_G01 CCAACCCACCAAAAAACGTCCAAAACCCACCCCAAA
T7_00020_G01 CAACCCAACCCCAAAAAGTCAAAACCCAACCAACCC

Total number of rows: 29317

Table truncated, full table size 1431 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap