NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL23950 Query DataSets for GPL23950
Status Public on Aug 25, 2017
Title Agilent-049943 mosquito array [probe name version]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organisms Tribolium castaneum; Bombyx mori; Aedes aegypti; Anopheles gambiae; Culex quinquefasciatus; Drosophila melanogaster; Apis mellifera
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Custom mosquito array containing probes of novel Anopheles gambiae miRNA and other insects

 
Submission date Aug 24, 2017
Last update date Aug 25, 2017
Contact name Lena Lampe
Organization name Max-Planck-Institute for Infection Biology
Street address Charit├ęplatz 1
City Berlin
ZIP/Postal code 13357
Country Germany
 
Samples (40) GSM2752776, GSM2752777, GSM2752778, GSM2752779, GSM2752780, GSM2752781 
Series (1)
GSE103034 miRNA expression in Anopheles gambiae tissues

Data table header descriptions
ID Agilent feature number
SPOT_ID
ACCESSION_STRING
miRNA_ID
miRNA_ID
CHROMOSOMAL_LOCATION
SEQUENCE

Data table
ID SPOT_ID ACCESSION_STRING miRNA_ID miRNA_ID CHROMOSOMAL_LOCATION SEQUENCE
A_38_P00001000 A_38_P00001000 mir|aga-miR-1891|mir|MIMAT0007862 aga-miR-1891 MIMAT0007862 unmapped CGCTCGGGTTTTCCCGAGCGGAAAACACGCAAATTAACTTTTTTTTTTT
A_38_P00001001 A_38_P00001001 mir|aga-miR-1891|mir|MIMAT0007862 aga-miR-1891 MIMAT0007862 unmapped CGCTCGGGTTTTCCCGAGCGGAAAACACGCAAATTAACTCTATTTTTTTT
A_38_P00001004 A_38_P00001004 mir|aga-bantam|mir|MIMAT0001494 aga-bantam MIMAT0001494 unmapped CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCAAAGTGAATTTTTTTTT
A_38_P00001005 A_38_P00001005 mir|aga-bantam|mir|MIMAT0001494 aga-bantam MIMAT0001494 unmapped CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCAAAGTGATTATTTTTTTT
A_38_P00001006 A_38_P00001006 mir|aga-bantam|mir|MIMAT0001494 aga-bantam MIMAT0001494 unmapped CGCTCGGGTTTTCCCGAGCGGAATCAGCTTTCAAAGTGATCATTTTTTTTT
A_38_P00001011 A_38_P00001011 mir|aga-miR-87|mir|MIMAT0007858 aga-miR-87 MIMAT0007858 unmapped CGCTCGGGTTTTCCCGAGCGGACACCTGAATATTTGCTCTTTTTTTTTT
A_38_P00001012 A_38_P00001012 mir|aga-miR-87|mir|MIMAT0007858 aga-miR-87 MIMAT0007858 unmapped CGCTCGGGTTTTCCCGAGCGGACACCTGAATATTTGCTCATTTTTTTTTT
A_38_P00001013 A_38_P00001013 mir|aga-miR-282|mir|MIMAT0001514 aga-miR-282 MIMAT0001514 unmapped CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGAATTTTTTTTTT
A_38_P00001014 A_38_P00001014 mir|aga-miR-282|mir|MIMAT0001514 aga-miR-282 MIMAT0001514 unmapped CGCTCGGGTTTTCCCGAGCGGACAGACAAAGCCTAGAAGTTTTTTTTTT
A_38_P00001017 A_38_P00001017 mir|aga-miR-34|mir|MIMAT0005526 aga-miR-34 MIMAT0005526 unmapped CGCTCGGGTTTTCCCGAGCGGACCAGCTAACCACACATTTTTTTTT
A_38_P00001018 A_38_P00001018 mir|aga-miR-34|mir|MIMAT0005526 aga-miR-34 MIMAT0005526 unmapped CGCTCGGGTTTTCCCGAGCGGACCAGCTAACCACACTTTTTTTTTTT
A_38_P00001023 A_38_P00001023 mir|aga-let-7|mir|MIMAT0001495 aga-let-7 MIMAT0001495 unmapped CGCTCGGGTTTTCCCGAGCGGACTATACAACCAACTACCTTTTTTTTTTT
A_38_P00001024 A_38_P00001024 mir|aga-let-7|mir|MIMAT0001495 aga-let-7 MIMAT0001495 unmapped CGCTCGGGTTTTCCCGAGCGGACTATACAACCAACTACCTCTTTTTTTTTT
A_38_P00001027 A_38_P00001027 mir|aga-miR-317|mir|MIMAT0001522 aga-miR-317 MIMAT0001522 unmapped CGCTCGGGTTTTCCCGAGCGGACTGAGATACCACCAGTATTTTTTTT
A_38_P00001028 A_38_P00001028 mir|aga-miR-317|mir|MIMAT0001522 aga-miR-317 MIMAT0001522 unmapped CGCTCGGGTTTTCCCGAGCGGACTGAGATACCACCAGAATTTTTTTTT
A_38_P00001032 A_38_P00001032 mir|aga-miR-1890|mir|MIMAT0007861 aga-miR-1890 MIMAT0007861 unmapped CGCTCGGGTTTTCCCGAGCGGAGACCTAATCAAAGATTTCTTTTTTTTTT
A_38_P00001033 A_38_P00001033 mir|aga-miR-1890|mir|MIMAT0007861 aga-miR-1890 MIMAT0007861 unmapped CGCTCGGGTTTTCCCGAGCGGAGACCTAATCAAAGATTTCATTTTTTTTTT
A_38_P00001034 A_38_P00001034 mir|aga-miR-996|mir|MIMAT0005528 aga-miR-996 MIMAT0005528 unmapped CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGTAATCTTTTTTTTTTT
A_38_P00001035 A_38_P00001035 mir|aga-miR-996|mir|MIMAT0005528 aga-miR-996 MIMAT0005528 unmapped CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGTAATCTATATTTTTTTT
A_38_P00001036 A_38_P00001036 mir|aga-miR-996|mir|MIMAT0005528 aga-miR-996 MIMAT0005528 unmapped CGCTCGGGTTTTCCCGAGCGGAGACGAGCATGTAATCTAGATTTTTTTTT

Total number of rows: 3824

Table truncated, full table size 592 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL23950_049943_D_GEO_20130606.txt.gz 1.5 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap