NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL26848 Query DataSets for GPL26848
Status Public on Mar 27, 2020
Title Agilent-085206 Gquad G4125A
Technology type in situ oligonucleotide
Distribution commercial
Organism synthetic construct
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
 
Submission date Jun 26, 2019
Last update date Mar 29, 2020
Contact name Desiree Tillo
E-mail(s) desiree.tillo@nih.gov
Phone +1-240-760-7289
Organization name NIH/NCI
Street address 41 Center Dr, Room D310
City Bethesda
State/province MD
ZIP/Postal code 20892
Country USA
 
Samples (32) GSM3906278, GSM3906279, GSM3906280, GSM3906281, GSM3906282, GSM3906283 
Series (2)
GSE133365 Custom DNA microarrays reveal diverse binding preferences of proteins and small molecules to thousands of G-quadruplexes [design 1]
GSE133368 Custom DNA microarrays reveal diverse binding preferences of proteins and small molecules to thousands of G-quadruplexes

Data table header descriptions
ID
SEQUENCE target sequence

Data table
ID SEQUENCE
AA1 TGGGGAGGGTGGGGAGGGTGGGGAAGGACTCAGGTGGGACACACTTTAACACATGGAGAG
AA10 TGGGGTGGGTGGGGGGGGTGGGGAAGGACTCAGGTGGGACACACTTTAACACATGGAGAG
AA100 TGGGGCCGGGTTGGGCCCCGGGCCGGGGAAGGGGTGGGACACACTTTAACACATGGAGAG
AA101 TGGGGCCGGGAAGGGCCCCGGGCCGGGGAAGGGGTGGGACACACTTTAACACATGGAGAG
AA102 TGGGGCCGGGGGGGGCCCCGGGCCGGGGAAGGGGTGGGACACACTTTAACACATGGAGAG
AA103 TGGGGTTGGGCCGGGCCCCGGGCCGGGGAAGGGGTGGGACACACTTTAACACATGGAGAG
AA104 TGGGGAAGGGCCGGGCCCCGGGCCGGGGAAGGGGTGGGACACACTTTAACACATGGAGAG
AA105 TGGGGGGGGGCCGGGCCCCGGGCCGGGGAAGGGGTGGGACACACTTTAACACATGGAGAG
AA106 TGGGGTTTGGGTTTGGGTTTTTTGGGTTTGGGGAAGGGACACACTTTAACACATGGAGAG
AA107 TGGGGAAAGGGAAAGGGAAAAAAGGGAAAGGGGAAGGGACACACTTTAACACATGGAGAG
AA108 TGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAAGGGACACACTTTAACACATGGAGAG
AA109 TGGGGCCCGGGCCCGGGCCCCCCGGGCCCGGGGAAGGGACACACTTTAACACATGGAGAG
AA11 TGGGGTGGGTGGGCCGGGTGGGGAAGGACTCAGGTGGGACACACTTTAACACATGGAGAG
AA110 TGGGGTTTGGGTTTGGGTTTTTTGGGAAAGGGGAAGGGACACACTTTAACACATGGAGAG
AA111 TGGGGTTTGGGTTTGGGTTTTTTGGGGGGGGGGAAGGGACACACTTTAACACATGGAGAG
AA112 TGGGGTTTGGGTTTGGGTTTTTTGGGCCCGGGGAAGGGACACACTTTAACACATGGAGAG
AA113 TGGGGTTTGGGTTTGGGAAAAAAGGGTTTGGGGAAGGGACACACTTTAACACATGGAGAG
AA114 TGGGGTTTGGGTTTGGGGGGGGGGGGTTTGGGGAAGGGACACACTTTAACACATGGAGAG
AA115 TGGGGTTTGGGTTTGGGCCCCCCGGGTTTGGGGAAGGGACACACTTTAACACATGGAGAG
AA116 TGGGGTTTGGGAAAGGGTTTTTTGGGTTTGGGGAAGGGACACACTTTAACACATGGAGAG

Total number of rows: 2264

Table truncated, full table size 150 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL26848_Gquad_085206_D_GEO_20171122.txt.gz 1.7 Mb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap