NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL28469 Query DataSets for GPL28469
Status Public on Jun 14, 2020
Title Microarrays of yeast nuclearly encoded tRNAs
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Saccharomyces cerevisiae
Manufacturer Fraunhofer Institute for Biomedical Research (Potsdam, Germany)
Manufacture protocol 1. Oligos were arrayed in 384 well plates with a final concentration of 10 µM in 3× SSC/0.01% SDS in a total volume of 25 µl.
2. Arrays were printed onto (3-Glycidyloxypropyl)trimethoxysilane (Sigma) activated glas slides using a contact-spotter (QArray 2, Molecular Devices).
3. After spotting arrays were incubated overnight at 4°C in a humidified atmosphere and subsequently dried for 30 min at 30°C.
4. Arrays were stored in a dry atmosphere at room temperature until use.
 
 
Submission date May 01, 2020
Last update date Dec 17, 2021
Contact name Zoya Ignatova
E-mail(s) zoya.ignatova@chemie.uni-hamburg.de
Organization name Universitaet Hamburg
Street address Martin -Luther-King-Platz 6
City Hamburg
ZIP/Postal code 20146
Country Germany
 
Samples (12) GSM4509135, GSM4509136, GSM4509137, GSM5727346, GSM5727347, GSM5727348 
Series (2)
GSE149697 eIF3 associates with 80S ribosomes to promote translation elongation, mitochondrial homeostasis, and muscle health
GSE190658 Not1 and Not4 inversely determine mRNA solubility that sets the dynamics of co-translational events

Data table header descriptions
ID
Anticodon
Codon Codons read by the detected tRNAs
SEQUENCE Full length probe sequences (5' to 3') isted in Kirchner S, Cai Z, Rauscher, R et al (207) Alteraiton of protein fucntion by a silent polymorphism linked to trNA. PloS Biol. 15, e 2000779; doi: 10.1371/journal.pbio.2000779

Data table
ID Anticodon Codon SEQUENCE
Ala1h Ala-IGC GCA/C/T (Ala) TGGAGAATGYGGGCGTCGATCCCRCTACCTCTYGCATGCTAAGCRAGCGCTCTACCRCCTGAGCTAATTCCCC
Ala2h Ala-A/C/UGC GCA/C/G/T (Ala) TGGAGRTGCCGGGGATYGAACCCGGGRCCTCRTRCATGCSAAGCAYGCGCTCTACCACTGAGCTACAYCCCC
Arg1h Arg-ICG CGT/C (Arg) CGAGCCAGCCAGGAGTCGAACCTRGAATCTTCTGATCCGTAGTCAGACGCGTTATCCATTGCGCCACTGGCCC
Arg2h Arg-C/UCG CGG/A (Arg) CAACCACGRAGGGACTCGAACCCTCAATCTTCTGATCCGRARTCAGACGCCTTATCCATTAGGCCACGCGGCC
Arg3h Arg-CCU AGG (Arg) TACCCCAGGTGGGACTCGAACCCACAATCCCTGGCTTAGGAGGCCAGTGCCTTATCCATTAGGCCACTGGGGC
Arg4h Arg-UCU AGA (Arg) CGACTCTGCYGGGACTCGAACCCGWAACCTTTGAATTAGAAGTCCAATGCGCTATCCATTGCGCCACAGAGCC
Asn1h Asn-GUU AAT/C (Asn) CGTCCCTGGGTGGGCTCGAACCACCAACCTTTCGGTTAACAGCCGAACGCGCTAACCGATTGCGCCACAGAGAC
Asp1h Asp-GUC GAT/C (Asp) CTCCCCGTCGGGGAATCGAACCCCGGTCTCCCGCGTGACAGGCGGGGATACTCACCACTATACTAACGAGGA
Cys1h Cys-TGT/TGC TGT/TGC (Cys) AGGGGGCACCYGGATTTGAACCRGGGACCTCTTGATCTGCAGTCAAATGCTCTACCMCTGAGCTATACCCCC
Gln1h Gln-C/UUU CAA/G (Gln) AGGTTCCACCGAGAYTTGAACTCGGATCGCTGGATTCARAGTCCAGAGTGCTHACCATTACACCATGGRACC
Glu1h Glu-C/UUC GAA/G (Glu) TTCCCTGACCGGGAATCGAACCCGGGCCWMGGCGGTGARAGCGCCGAATCCTARCCACTAGACCACCAGGGR
Glu2h Gln-UUC GAA (Glu) TTCCCAYACCGGGAGTCGAACCCGGGCCRCCTGGGTGAAAACCAGGAATCCTAACCGCTAGACCATRTGGGA
Gly1h Gly-G/CCC GGC/T/G (Gly) TGCATTGGCCRGGAATYGAACCCGGGYCTCCCRCGTGGWAGGCGAGAATTCTACCACTGMACCACCMAYGC
Gly2h Gly-UCC GGA (Gly) TGCGTTGGCCGGGAATCGAACCCGGGTCAACTGCTTGGAAGGCAGCTATGCTCACCACTATACCACCAACGC
His1h His-GUG CAT/C (His) TGCCGTGACTCGGATTCGAACCGAGGTTGCTGCGGCCACAACGCAGAGTACTAACCACTATACGATCACGGC
Ile1h Ile-IAU ATT/C (Ile) TGGCCMGTACGGGGATCGAACCCGCGACCTTGGCGTTATTAGCACCACGCTCTAACCAACTGAGCTAACCRGCC
Ile2h Ile-UAU ATA (Ile) TGCTCCAGGTGAGGMTCGAACTCACAACCTCGGCATTATAAGTACCGCGCGCTAACCGATTGCGCCACTGGAGC
Leu1h Leu-A/UAG CTT/C/A (Leu) TGGCAGYGGTGGGATTCRAACCCACGCCYCCGAARAGACTGGAGCCTTAATCCAGCGCCTTAGACCRCTCGGCCACRCTA
Leu2h Leu-CAG CTG (Leu) TGTCARAAGTGGGATTCGAACCCACGCCTCCAGWGGAGGWTGCGATTTGAACGCAGCGCCTTAAGACYGCTCGGCCATCC
Leu3h Leu-CAA TTG (Leu) TGTCAGAAGTGGGATTCGAACCCACGCCTCCATTGGAGACCAGAACTTGAGTCTGGCGCCTTAGACCACTCGGCCATCC

Total number of rows: 43

Table truncated, full table size 4 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap