NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL29025 Query DataSets for GPL29025
Status Public on Aug 16, 2020
Title Duke/RG_MM_v1
Technology type in situ oligonucleotide
Distribution custom-commercial
Organisms Saccharomyces cerevisiae; Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol In situ oligosynthesized array with proprietary synthetic sequences that contain transcription factor binding sites and their 1-base variants.
 
 
Submission date Aug 15, 2020
Last update date Aug 16, 2020
Contact name Raluca Gordan
E-mail(s) raluca.gordan@duke.edu
Organization name Duke University
Department Center for Genomic and Computational Biology
Street address 101 Science Dr, CIEMAS 2179
City Durham
State/province NC
ZIP/Postal code 27708
Country USA
 
Samples (8) GSM4728729, GSM4728730, GSM4728731, GSM4728732, GSM4728733, GSM4728734 
Series (2)
GSE156304 DNA mismatches reveal conformational penalties in protein-DNA recognition I
GSE156375 DNA mismatches reveal conformational penalties in protein-DNA recognition

Data table header descriptions
ID
PROBE_ID Probe ID
NAME Probe name
SEQUENCE Probe sequence
SPOT_ID

Data table
ID PROBE_ID NAME SEQUENCE SPOT_ID
1 Ctrl_mis_000001 seq01_wt0_r01 CGGAAGTGTCGTAAACGTCGGATATCCGGTTCTTCTGGGCGCTAAGGGAGCTGACGGAGA seq01_wt0_r01
2 Ctrl_mis_000002 seq02_wt0_r01 GCTGCTGCGGTGCATACCCCACCGGATGTGACCCCGTGATGCGGTCTTGATTCGCTTGAC seq02_wt0_r01
3 Ctrl_mis_000003 seq03_wt0_r01 TAAAGGGAAGACGGTTGTGGTAGTTCCGGGTATTAACCTGTGTGGCGCGGGGTCTGAGGC seq03_wt0_r01
4 Ctrl_mis_000004 seq04_wt0_r01 GGAAAAAGGCCCAGGGTAACACCGGAAGTGGGCTTATTTGCGCATCAGCTACTTTCGCTT seq04_wt0_r01
5 Ctrl_mis_000005 seq05_wt0_r01 TCCGGCTACCAGCTCCACCCACTTCAGGCCTTGTAGGGCTCTGGGAAATGTAGTGTTTTT seq05_wt0_r01
6 Ctrl_mis_000006 seq06_wt0_r01 CAGCATAGGACTTCTTCCCTGAAGCAATTGATAACCCCGGTCTACGATGCGTGGTTCCAA seq06_wt0_r01
7 Ctrl_mis_000007 seq07_wt0_r01 CTGGGACTTGACCCAACTCTGCCACGTGGGTCGTTTTGCCATCGACAGATTGGGAGATTT seq07_wt0_r01
8 Ctrl_mis_000008 seq08_wt0_r01 GATTAATTTCTGCCCTTATTCGCACGTGCCATAACACCTGTACCTCTCACACTAAAGACC seq08_wt0_r01
9 Ctrl_mis_000009 seq09_wt0_r01 TGTCGGGTAAGGGAATGTAGATCACGTGAATGAAAATTCAAGTGTTTTTCGAAAAGTTTC seq09_wt0_r01
10 Ctrl_mis_000010 seq10_wt0_r01 GTGTATAGGATCCCATCCAACACACGTGTTAAAATGACATCAGGTATCAATGCTAATCCG seq10_wt0_r01
11 Ctrl_mis_000011 seq11_wt0_r01 CACAATTTTTACAGTAATGTAGCACGCGTAACTCCTAAACTTTGTCATAATGGTTGAAAT seq11_wt0_r01
12 Ctrl_mis_000012 seq12_wt0_r01 TACTGACTTATATATGCGAATGCACATGAATAGACCGCATATGCTTCTTATCAGTCTTAC seq12_wt0_r01
13 Ctrl_mis_000013 seq01_wt0_r02 CGGAAGTGTCGTAAACGTCGGATATCCGGTTCTTCTGGGCGCTAAGGGAGCTGACGGAGA seq01_wt0_r02
14 Ctrl_mis_000014 seq02_wt0_r02 GCTGCTGCGGTGCATACCCCACCGGATGTGACCCCGTGATGCGGTCTTGATTCGCTTGAC seq02_wt0_r02
15 Ctrl_mis_000015 seq03_wt0_r02 TAAAGGGAAGACGGTTGTGGTAGTTCCGGGTATTAACCTGTGTGGCGCGGGGTCTGAGGC seq03_wt0_r02
16 Ctrl_mis_000016 seq04_wt0_r02 GGAAAAAGGCCCAGGGTAACACCGGAAGTGGGCTTATTTGCGCATCAGCTACTTTCGCTT seq04_wt0_r02
17 Ctrl_mis_000017 seq05_wt0_r02 TCCGGCTACCAGCTCCACCCACTTCAGGCCTTGTAGGGCTCTGGGAAATGTAGTGTTTTT seq05_wt0_r02
18 Ctrl_mis_000018 seq06_wt0_r02 CAGCATAGGACTTCTTCCCTGAAGCAATTGATAACCCCGGTCTACGATGCGTGGTTCCAA seq06_wt0_r02
19 Ctrl_mis_000019 seq07_wt0_r02 CTGGGACTTGACCCAACTCTGCCACGTGGGTCGTTTTGCCATCGACAGATTGGGAGATTT seq07_wt0_r02
20 Ctrl_mis_000020 seq08_wt0_r02 GATTAATTTCTGCCCTTATTCGCACGTGCCATAACACCTGTACCTCTCACACTAAAGACC seq08_wt0_r02

Total number of rows: 15108

Table truncated, full table size 1626 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap