NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL29073 Query DataSets for GPL29073
Status Public on Aug 29, 2020
Title Duke/RG_MM_v2
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism synthetic construct
Manufacturer Agilent Technologies
Manufacture protocol In situ oligosynthesized array with proprietary synthetic sequences that contain transcription factor binding sites and their 1-base variants.
 
 
Submission date Aug 28, 2020
Last update date Aug 29, 2020
Contact name Raluca Gordan
E-mail(s) raluca.gordan@duke.edu
Organization name Duke University
Department Center for Genomic and Computational Biology
Street address 101 Science Dr, CIEMAS 2179
City Durham
State/province NC
ZIP/Postal code 27708
Country USA
 
Samples (7) GSM4751875, GSM4751876, GSM4751877, GSM4751878, GSM4751879, GSM4751880 
Series (2)
GSE156375 DNA mismatches reveal conformational penalties in protein-DNA recognition
GSE157064 DNA mismatches reveal conformational penalties in protein-DNA recognition III

Data table header descriptions
ID Probe ID
PROBE_ID
NAME Probe name
SEQUENCE Probe sequence

Data table
ID PROBE_ID NAME SEQUENCE
1 Ctrl_MM2_000001 MM_2nd_1WT_r1 ACACACATGAGATATCTGATGCCTTCCGTGTGGTTAGCCAGGTGTAGTTTGGTCGTAGTG
2 Ctrl_MM2_000002 MM_2nd_2WT_r1 GAGATGGCGCCTGTTATCTTCTGCCCTGTTCCGGTATTCAATATCTCTGGGCTTGCTCAG
3 Ctrl_MM2_000003 MM_2nd_3WT_r1 TGATGGTGGCGTGGGCGATAAGGAGGGGTAAGCGGTAAGGCTAAAGGAGGGGAAAGAGGC
4 Ctrl_MM2_000004 MM_2nd_4WT_r1 AACTTTGATATCATTGCACGTGTTTACTTATTTAGAGGTATCGTTGTTCGACGTTTTAGG
5 Ctrl_MM2_000005 MM_2nd_5WT_r1 GTGCCCGGCGCCCACGCGGGCGACACCTCCTCGTCGGTTATGAAGGGTGAAAAGGCACTC
6 Ctrl_MM2_000006 MM_2nd_6WT_r1 TTTCTTTCTTATGTGGTTTTTGATACTCTGGGACAGAATGTTTACGTGGTAAGTGTGTTG
7 Ctrl_MM2_000007 MM_2nd_7WT_r1 CATCTGCCCTGCGGTTTCCTTCTGCCTGATAAGATTTCACCTGTCATCTTTTTGCCTCCC
8 Ctrl_MM2_000008 MM_2nd_8WT_r1 GCGTAGTGCCACCTGGTGGCCACGTGCCAACGTCACCTTCTGTATAGTGGTGGAGTGACC
9 Ctrl_MM2_000009 MM_2nd_9WT_r1 GGCAGCGCCCTCTACTGGCAGCTGCACGTGGTGGCCGCGCGCGCCGAGGCGGTGAGCGTG
10 Ctrl_MM2_000010 MM_2nd_10WT_r1 TCAAAACCGCAGGGGGGCGCTATGGCGCCATGTCACTGATAGTCGGGTGTCAATGGAAAC
11 Ctrl_MM2_000011 MM_2nd_11WT_r1 CCCGGTGACGTAAACGTCGGATATCCGGTTCTTCTGGGCGCTAAGGGAGCTGACGGAGAA
12 Ctrl_MM2_000012 MM_2nd_12WT_r1 GGTTTGTGGCCACCAGGTGGCACTAGGAATGTTCTGTGTTTTATGTCCCACCACCCAAGG
13 Ctrl_MM2_000013 MM_2nd_1WT_r2 ACACACATGAGATATCTGATGCCTTCCGTGTGGTTAGCCAGGTGTAGTTTGGTCGTAGTG
14 Ctrl_MM2_000014 MM_2nd_2WT_r2 GAGATGGCGCCTGTTATCTTCTGCCCTGTTCCGGTATTCAATATCTCTGGGCTTGCTCAG
15 Ctrl_MM2_000015 MM_2nd_3WT_r2 TGATGGTGGCGTGGGCGATAAGGAGGGGTAAGCGGTAAGGCTAAAGGAGGGGAAAGAGGC
16 Ctrl_MM2_000016 MM_2nd_4WT_r2 AACTTTGATATCATTGCACGTGTTTACTTATTTAGAGGTATCGTTGTTCGACGTTTTAGG
17 Ctrl_MM2_000017 MM_2nd_5WT_r2 GTGCCCGGCGCCCACGCGGGCGACACCTCCTCGTCGGTTATGAAGGGTGAAAAGGCACTC
18 Ctrl_MM2_000018 MM_2nd_6WT_r2 TTTCTTTCTTATGTGGTTTTTGATACTCTGGGACAGAATGTTTACGTGGTAAGTGTGTTG
19 Ctrl_MM2_000019 MM_2nd_7WT_r2 CATCTGCCCTGCGGTTTCCTTCTGCCTGATAAGATTTCACCTGTCATCTTTTTGCCTCCC
20 Ctrl_MM2_000020 MM_2nd_8WT_r2 GCGTAGTGCCACCTGGTGGCCACGTGCCAACGTCACCTTCTGTATAGTGGTGGAGTGACC

Total number of rows: 15100

Table truncated, full table size 1513 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap