NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL29478 Query DataSets for GPL29478
Status Public on Mar 23, 2021
Title miRCURY LNA microRNA Array, v.10.0 - hsa, mmu & rno (miRBase v10.1)
Technology type spotted oligonucleotide
Distribution custom-commercial
Organisms Mus musculus; Murid betaherpesvirus 1; Murid gammaherpesvirus 4
Manufacturer Exiqon A/S
Manufacture protocol standard Exiqon protocol for production of commercial array
 
 
Submission date Dec 07, 2020
Last update date Mar 23, 2021
Contact name Yue Lu
E-mail(s) ylu4@mdanderson.org
Phone 7135637960
Organization name The University of Texas MD Anderson Cancer Center
Department Epigenetics & Molecular Carcinogenesis
Street address 1881 East Road
City Houston
State/province TX
ZIP/Postal code 77054
Country USA
 
Samples (7) GSM4959973, GSM4959974, GSM4959975, GSM4959976, GSM4959977, GSM4959978 
Series (1)
GSE162793 BK5.ATF3-induced mammary tumors compared to normal mammary glands

Data table header descriptions
ID Array probe ID number
ID number
Block Block number in slide layout
Column Column in block
Row Row in block
Name Annotation
miRNA_ID_LIST Targeted miRNA(s)
Status spot type, one of: blank, mmu_probe, spike_control, hsa_control, Hy3
Accession miRBase v10.1 accession number
Sequence miRBase v10.1 sequence
SPOT_ID

Data table
ID ID number Block Column Row Name miRNA_ID_LIST Status Accession Sequence SPOT_ID
1 13138 1 1 1 Hy3 Hy3 Hy3
2 4610 1 2 1 mmu-miR-126-3p mmu-miR-126-3p mmu_probe MIMAT0000138 UCGUACCGUGAGUAAUAAUGCG
3 10977 1 3 1 mmu-miR-183 mmu-miR-183 mmu_probe MIMAT0000212 UAUGGCACUGGUAGAAUUCACU
4 14266 1 4 1 hsa_negative_control_4 hsa_control CONTROL
5 11102 1 5 1 mmu-miR-410 mmu-miR-410 mmu_probe MIMAT0001091 AAUAUAACACAGAUGGCCUGU
6 19603 1 6 1 hsa_SNORD13 hsa_control CONTROL
7 13145 1 7 1 mmu-miR-369-5p mmu-miR-369-5p mmu_probe MIMAT0003185 AGAUCGACCGUGUUAUAUUCGC
8 17306 1 8 1 blank
9 17470 1 9 1 blank
10 17570 1 10 1 blank
11 17660 1 11 1 blank
12 17883 1 12 1 blank
13 19591 1 13 1 blank
14 5740 1 14 1 mmu-miR-21 mmu-miR-21 mmu_probe MIMAT0000530 UAGCUUAUCAGACUGAUGUUGA
15 10987 1 15 1 blank
16 13138 1 16 1 Hy3 Hy3 Hy3
17 11043 1 1 2 mmu-miR-302b mmu-miR-302b mmu_probe MIMAT0003374 UAAGUGCUUCCAUGUUUUAGUAG
18 14257 1 2 2 spike_control_i spike_control CONTROL
19 11111 1 3 2 blank
20 11166 1 4 2 blank

Total number of rows: 5632

Table truncated, full table size 315 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL29478_gal_208100-A_lot30004-30011_mmu-and-related-vira_from_mb101.gal.gz 28.0 Kb (ftp)(http) GAL

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap