NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL29513 Query DataSets for GPL29513
Status Public on Apr 22, 2021
Title Duke/RG_CbfPho_v2_Apr2019
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism synthetic construct
Manufacturer Agilent Technologies
Manufacture protocol In situ oligosynthesized array with proprietary synthetic sequences that target Cbf1/Pho4 putative binding sites in genomic context.
 
 
Submission date Dec 18, 2020
Last update date Dec 18, 2020
Contact name Raluca Gordan
E-mail(s) raluca.gordan@duke.edu
Organization name Duke University
Department Center for Genomic and Computational Biology
Street address 101 Science Dr, CIEMAS 2179
City Durham
State/province NC
ZIP/Postal code 27708
Country USA
 
Samples (22) GSM4980337, GSM4980338, GSM4980339, GSM4980340, GSM4980341, GSM4980342 
Series (3)
GSE163509 Competition for DNA binding between paralogous transcription factors determines their genomic occupancy and regulatory functions [competition]
GSE163511 Competition for DNA binding between paralogous transcription factors determines their genomic occupancy and regulatory functions [titration]
GSE163512 Competition for DNA binding between paralogous transcription factors determines their genomic occupancy and regulatory functions

Data table header descriptions
ID Probe name
Sequence Probe sequence

Data table
ID Sequence
MitomiProbe_mut_1 AAAGCGGTAATTTAACACGTGTTTTCACATATCTAT
MitomiProbe_mut_10 AAAGCGGTAATTTGAAACGTGGGTGCAGATATCTAT
MitomiProbe_mut_100 AAAGCGGTAATTTGCCGCGTGGGTGCAGATATCTAT
MitomiProbe_mut_1000 CATACCCAACCTTGGTTAGTGGGTGAAGATATTTGT
MitomiProbe_mut_1001 CATACCCAACCTTGGTTCGTGGGTGAAGATATTTGT
MitomiProbe_mut_1002 CATACCCAACCTTGGTTGGTGGGTGAAGATATTTGT
MitomiProbe_mut_1003 CATACCCAACCTTGGTTTGTGGGTGAAGATATTTGT
MitomiProbe_mut_1004 CATACCCAACCTTGTAAAGTGGGTGAAGATATTTGT
MitomiProbe_mut_1005 CATACCCAACCTTGTAACGTGGGTGAAGATATTTGT
MitomiProbe_mut_1006 CATACCCAACCTTGTAAGGTGGGTGAAGATATTTGT
MitomiProbe_mut_1007 CATACCCAACCTTGTAATGTGGGTGAAGATATTTGT
MitomiProbe_mut_1008 CATACCCAACCTTGTACAGTGGGTGAAGATATTTGT
MitomiProbe_mut_1009 CATACCCAACCTTGTACCGTGGGTGAAGATATTTGT
MitomiProbe_mut_101 AAAGCGGTAATTTGCCGGGTGGGTGCAGATATCTAT
MitomiProbe_mut_1010 CATACCCAACCTTGTACGGTGGGTGAAGATATTTGT
MitomiProbe_mut_1011 CATACCCAACCTTGTACTGTGGGTGAAGATATTTGT
MitomiProbe_mut_1012 CATACCCAACCTTGTAGAGTGGGTGAAGATATTTGT
MitomiProbe_mut_1013 CATACCCAACCTTGTAGCGTGGGTGAAGATATTTGT
MitomiProbe_mut_1014 CATACCCAACCTTGTAGGGTGGGTGAAGATATTTGT
MitomiProbe_mut_1015 CATACCCAACCTTGTAGTGTGGGTGAAGATATTTGT

Total number of rows: 10276

Table truncated, full table size 648 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap