 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 04, 2021 |
| Title |
UMCU-42 |
| Technology type |
in situ oligonucleotide |
| Distribution |
custom-commercial |
| Organism |
Mus musculus |
| Manufacturer |
UMC Utrecht, The Netherlands |
| Manufacture protocol |
UMC Utrecht, The Netherlands
|
| |
|
| |
|
| Submission date |
Feb 03, 2021 |
| Last update date |
Feb 04, 2021 |
| Contact name |
Cristina Reschke |
| E-mail(s) |
cristinarreschke@rcsi.ie
|
| Phone |
+353871607758
|
| Organization name |
Royal College of Surgeons in Ireland
|
| Street address |
123 St Stephens Green, Dublin 2
|
| City |
Dublin |
| ZIP/Postal code |
Dublin 2 |
| Country |
Ireland |
| |
|
| Samples (8)
|
GSM5061768, GSM5061769, GSM5061770, GSM5061771, GSM5061772, GSM5061773
|
| Series (1) |
| GSE166097 |
Murine hippocampus: Scramble (control) vs Antagomir-134 |
|
| Data table header descriptions |
| ID |
|
| SPOT_ID |
|
| reporterSequence |
|
| reporterDescription |
|
| reporterGroup |
|
| reporterStart |
|
| reporterEnd |
|
| Agilent Probe Name |
|
| bioSequenceId |
|
| systematicName |
|
| ORF |
|
| bioSeqDescription |
|
| chromosomeName |
|
| bioSeqStartPosition |
|
| bioSeqEndPosition |
|
| strand |
|
| biologicalProcess |
|
| molecularFunction |
|
| cellularComponent |
|
| crossReference1 |
|
| crossReference2 |
|
| crossReference3 |
|
| crossReference5 |
|
| crossReference6 |
|
| Data table |
| ID |
SPOT_ID |
reporterSequence |
reporterDescription |
reporterGroup |
reporterStart |
reporterEnd |
Agilent Probe Name |
bioSequenceId |
systematicName |
ORF |
bioSeqDescription |
chromosomeName |
bioSeqStartPosition |
bioSeqEndPosition |
strand |
biologicalProcess |
molecularFunction |
cellularComponent |
crossReference1 |
crossReference2 |
crossReference3 |
crossReference5 |
crossReference6 |
| 1 |
QCAA003595 |
|
|
qc_control |
|
|
GE_BrightCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 2 |
QCAA003595 |
|
|
qc_control |
|
|
GE_BrightCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 3 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 4 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 5 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 6 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 7 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 8 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 9 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 10 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 11 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 12 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 13 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 14 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 15 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 16 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 17 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 18 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 19 |
QCAA000454 |
|
Agilent positive control |
qc_control |
|
|
DarkCorner |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 20 |
MMAB001967 |
CTCAGAAGACCAACAAAGAGCTCACTTCTCTGTGAGCGAGACAAATTAGCACCTCAAGTT |
"agilent: Cyb5rl; gb|AK053031|ens|ENSMUST00000106756|ens|ENSMUST00000094921|gb|AK220154; Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:D930024J19 product:hypothetical Oxidoreductase FAD and NAD(P)-binding domain [AK053031" |
gene |
107072482 |
107072541 |
A_51_P143341 |
ensembl:ENSMUSG00000028621.76_38 |
ENSMUSG00000028621 |
Cyb5rl |
cytochrome b5 reductase-like [Source:MGI Symbol;Acc:MGI:1919657] |
4 |
107068605 |
107085826 |
1 |
GO:0055114 |
GO:0016491;GO:0004128 |
GO:0005575 |
ensembl:ENSMUSG00000028621 |
uniprot:B1AS39 |
entrez:230582 |
embl:AK220154 |
mgi:MGI:1919657 |
Total number of rows: 45220
Table truncated, full table size 25343 Kbytes.
| Supplementary data files not provided |
|
|
|
|
 |
Less...
More...