NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL32365 Query DataSets for GPL32365
Status Public on Jun 30, 2023
Title ╬╝Paraflo human and HCMV MicroRNA Microarray Assay
Technology type in situ oligonucleotide
Distribution custom-commercial
Organisms Homo sapiens; Human betaherpesvirus 5
Manufacturer LC Sciences
Manufacture protocol Standard protocol
 
 
Submission date Jun 17, 2022
Last update date Jun 30, 2023
Contact name Xuan Jiang
E-mail(s) xuanj102310@gmail.com
Phone 47-96741417
Organization name University of Oslo
Department Department of Medical Genetics
Lab Computational biology group
Street address Kirkeveien 166E, 906, 906, 906, 906
City OSLO
ZIP/Postal code 0450
Country Norway
 
Samples (10) GSM6252708, GSM6252709, GSM6252710, GSM6252711, GSM6252712, GSM6252713 
Series (1)
GSE206370 Human cytomegalovirus infection perturbs neural progenitor cell fate via the expression of viral microRNAs

Data table header descriptions
ID
miRNA_ID
Target sequence
Block
Row
Column
Group
Reporter Control Type
SPOT_ID

Data table
ID miRNA_ID Target sequence Block Row Column Group Reporter Control Type SPOT_ID
1 1 1 1 control control_empty BKG0
2 hsa-let-7a-2-3p CUGUACAGCCUCCUAGCUUUCC 1 1 2 experimental
3 hsa-miR-1273g-5p GGUGGUUGAGGCUGCAGUAAGU 1 1 3 experimental
4 hsa-miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU 1 1 4 experimental
5 hsa-miR-2276 UCUGCAAGUGUCAGAGGCGAGG 1 1 5 experimental
6 hsa-miR-3147 GGUUGGGCAGUGAGGAGGGUGUGA 1 1 6 experimental
7 hsa-miR-3591-3p AAACACCAUUGUCACACUCCAC 1 1 7 experimental
8 hsa-miR-378a-3p ACUGGACUUGGAGUCAGAAGG 1 1 8 experimental
9 hsa-miR-4296 AUGUGGGCUCAGGCUCA 1 1 9 experimental
10 hsa-miR-4494 CCAGACUGUGGCUGACCAGAGG 1 1 10 experimental
11 hsa-miR-4667-3p UCCCUCCUUCUGUCCCCACAG 1 1 11 experimental
12 hsa-miR-4747-5p AGGGAAGGAGGCUUGGUCUUAG 1 1 12 experimental
13 hsa-miR-5002-3p UGACUGCCUCACUGACCACUU 1 1 13 experimental
14 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA 1 1 14 experimental
15 hsa-miR-5683 UACAGAUGCAGAUUCUCUGACUUC 1 1 15 experimental
16 1 1 16 control control_empty BKG0
17 hsa-miR-652-3p AAUGGCGCCACUAGGGUUGUG 1 1 17 experimental
18 hsa-miR-130a-5p UUCACAUUGUGCUACUGUCUGC 1 1 18 experimental
19 hsa-miR-195-3p CCAAUAUUGGCUGUGCUGCUCC 1 1 19 experimental
20 hsa-miR-29b-2-5p CUGGUUUCACAUGGUGGCUUAG 1 1 20 experimental

Total number of rows: 3968

Table truncated, full table size 249 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap