NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL3548 Query DataSets for GPL3548
Status Public on Mar 16, 2006
Title SLRI_Zebrafish_3.5k_v1
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Danio rerio
Manufacturer SLRI/Mount Sinai Hospital, Toronto, Ontario, Canada
Manufacture protocol This microarray is printed in triplicate with Operon's the Zebrafish Genome Oligo Set Version 1.0 contains 3,479 70mer probes representing 3,479 Danio rerio genes. The set of 3,479 probes represents cloned Zebrafish genes and some expressed sequence tags (ESTs). For our probe design we use state-of-the-art methodology and proprietary software. All probes are designed from the UniGene Database Build Dr 41, and the Zebrafish Reference Sequence (RefSeq) database, developed and maintained at the National Center of Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov). For the oligo set design, we selected 1,206 sequences, representing well-annotated genes, and 2,273 ESTs with high or moderate homology to known genes. The probes are Tm normalized to 78ºC (±5ºC) and have a 5' amino linker. The concentration of all probes are normalized to 40 micromolar and printed on NUNC poly-L-lysine coated slides using BioRad VersArray Chipwriter Pro.
Support glass
 
 
Web link http://www.mshri.on.ca/Microarray
Contributor(s) Ho C, Chan C
Submission date Mar 14, 2006
Last update date Jan 18, 2013
Contact name Chi-Yip Ho
E-mail(s) cyho@mshri.on.ca
Phone 416-586-1589
Fax 416-586-8869
URL http://www.mshri.on.ca/microarray
Organization name SLRI/Mount Sinai Hospital
Department Research
Lab Microarray Laboratory
Street address 600 University Ave. rm-981
City Toronto
State/province Ontario
ZIP/Postal code M5G 1X5
Country Canada
 
Samples (8) GSM173319, GSM173456, GSM173457, GSM173458, GSM173459, GSM173557 
Series (1)
GSE7220 Microarray analysis in the zebrafish liver and telencephalon after exposure to low concentration of 17a-EE2

Data table header descriptions
ID
BLOCK Sub-Grid
COLUMN Column of Sub-Grid
ROW Row of Sub-Grid
GB_ACC GenBank Accession Number
OLIGO_ID Operon's Oligo ID
GENE_SYMBOL Gene Symbol
SEQUENCE Oligo Sequence of the Probe
DESCRIPTION Description
LOCUS_LINK Locus Link
CHROMOSOME Chromosome where the Gene Located
SPOT_ID

Data table
ID BLOCK COLUMN ROW GB_ACC OLIGO_ID GENE_SYMBOL SEQUENCE DESCRIPTION LOCUS_LINK CHROMOSOME SPOT_ID
1 1 1 1 Phosphate Buffer -- BUFFER
2 1 2 1 Phosphate Buffer -- BUFFER
3 1 3 1 Phosphate Buffer -- BUFFER
4 1 4 1 AW174421 Dr0002985 GCAGCTTTCATCGCCTCATCACGTCTTGTCAACTTTTTGCCCTTTTTGAGGAACAAAACGCACTTTTTTG ESTs Moderately similar to hypothetical protein FLJ20419 [Homo sapiens] [H.sapiens]
5 1 5 1 AW174421 Dr0002985 GCAGCTTTCATCGCCTCATCACGTCTTGTCAACTTTTTGCCCTTTTTGAGGAACAAAACGCACTTTTTTG ESTs Moderately similar to hypothetical protein FLJ20419 [Homo sapiens] [H.sapiens]
6 1 6 1 AW174421 Dr0002985 GCAGCTTTCATCGCCTCATCACGTCTTGTCAACTTTTTGCCCTTTTTGAGGAACAAAACGCACTTTTTTG ESTs Moderately similar to hypothetical protein FLJ20419 [Homo sapiens] [H.sapiens]
7 1 7 1 AL716464 Dr0002245 AAATTCTCTGACATCTCTTCACATCTTGTTGGCTTTCCAGGAGAGGTAAGAGTTCCAGACAACAGCCACG ESTs Moderately similar to MpV17 transgene murine homolog glomerulosclerosis; Mpv17 human homolog of glomerulosclerosis and nephrotic syndrome [Homo sapiens] [H.sapiens]
8 1 8 1 AL716464 Dr0002245 AAATTCTCTGACATCTCTTCACATCTTGTTGGCTTTCCAGGAGAGGTAAGAGTTCCAGACAACAGCCACG ESTs Moderately similar to MpV17 transgene murine homolog glomerulosclerosis; Mpv17 human homolog of glomerulosclerosis and nephrotic syndrome [Homo sapiens] [H.sapiens]
9 1 9 1 AL716464 Dr0002245 AAATTCTCTGACATCTCTTCACATCTTGTTGGCTTTCCAGGAGAGGTAAGAGTTCCAGACAACAGCCACG ESTs Moderately similar to MpV17 transgene murine homolog glomerulosclerosis; Mpv17 human homolog of glomerulosclerosis and nephrotic syndrome [Homo sapiens] [H.sapiens]
10 1 10 1 BM775337 Dr0001493 CTTCTCTGCAAATATCAATACCGGCGGTGGGGTTTTCTGAAGACACTCCAGCAGATAAACCATCTTGGCC ESTs Highly similar to DEAD-box protein abstrakt [Homo sapiens] [H.sapiens]
11 1 11 1 BM775337 Dr0001493 CTTCTCTGCAAATATCAATACCGGCGGTGGGGTTTTCTGAAGACACTCCAGCAGATAAACCATCTTGGCC ESTs Highly similar to DEAD-box protein abstrakt [Homo sapiens] [H.sapiens]
12 1 12 1 BM775337 Dr0001493 CTTCTCTGCAAATATCAATACCGGCGGTGGGGTTTTCTGAAGACACTCCAGCAGATAAACCATCTTGGCC ESTs Highly similar to DEAD-box protein abstrakt [Homo sapiens] [H.sapiens]
13 1 13 1 U89295 Dr000753 ek1 GATGTCATCCTTTCTTAAAACTGGCAGCAACTTCCTCTCTTTGTCAAGCCGCTCCATTTGATGTGGCTTT eph-like kinase 1 30311 24
14 1 14 1 U89295 Dr000753 ek1 GATGTCATCCTTTCTTAAAACTGGCAGCAACTTCCTCTCTTTGTCAAGCCGCTCCATTTGATGTGGCTTT eph-like kinase 1 30311 24
15 1 15 1 U89295 Dr000753 ek1 GATGTCATCCTTTCTTAAAACTGGCAGCAACTTCCTCTCTTTGTCAAGCCGCTCCATTTGATGTGGCTTT eph-like kinase 1 30311 24
16 1 16 1 AF385081 Dr000297 CAACAGATCCACAGAGTCTCTGCAGGCCAATGTCCAGAGGCTGAAGGAATACCGCACCAAACTCATCATC Danio rerio 60S ribosomal protein L13 mRNA complete cds
17 1 17 1 AF385081 Dr000297 CAACAGATCCACAGAGTCTCTGCAGGCCAATGTCCAGAGGCTGAAGGAATACCGCACCAAACTCATCATC Danio rerio 60S ribosomal protein L13 mRNA complete cds
18 1 18 1 AF385081 Dr000297 CAACAGATCCACAGAGTCTCTGCAGGCCAATGTCCAGAGGCTGAAGGAATACCGCACCAAACTCATCATC Danio rerio 60S ribosomal protein L13 mRNA complete cds
19 1 1 2 Phosphate Buffer -- BUFFER
20 1 2 2 Phosphate Buffer -- BUFFER

Total number of rows: 12672

Table truncated, full table size 2159 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap