GEO Accession viewer

GSE7902	Novel cell lines from mouse epiblast share defining features with human embryonic stem cells
GSE8294	Microarray analysis of monocytes recruited in the peritoneum during experimental infection with Listeria monocytogenes
GSE9305	Gene expression profiles of primary tumors with radiotherapy and lung metastases in mouse squamous cell carcinoma model.
GSE9736	Gene expression profiling of IL-18 stimulated, in vitro differentiated mouse mucosal mast cells (MMC)
GSE9802	Effect of acute muscle unloading on soleus and gastrocnemius muscle gene expression
GSE10310	Comprehensive transcriptional profiling of prion infection in mouse models reveals networks of responsive genes.
GSE10390	Sex-dependent and HNF4alpha-dependent Mouse Liver Gene Expression
GSE10417	The effect of PPAR-alpha agonist on the gene expression in mice hypothalamus.
GSE10421	Liver expression of Bmp6, Smad7, Id1 and Atoh8 is regulated by iron stores
GSE10450	Met induces mammary tumors with diverse histologies and is associated with poor outcome and human basal breast cancer
GSE10882	Transcription profile of CD103- vs CD103+ dendritic cells derived from CX3CR1+c-kit+- bone marrow cells (M1993 M2067)
GSE11229	Dicer-null cell lines vs. wt ES cells and Dicer-null cell lines vs. Dicer-null cells overexpressing Dnmt1 or Dnmt3a/3b
GSE11240	An RNAi Screen of Chromatin Proteins Identifies Tip60-p400 as a Regulator of Embryonic Stem Cell Identity, Experiment A
GSE11243	An RNAi Screen of Chromatin Proteins Identifies Tip60-p400 as a Regulator of Embryonic Stem Cell Identity
GSE11507	Gene expression profiles of sclerosing cholangitis activity in mice
GSE11890	PKGI WT vs KO BAT
GSE11910	Effects of psychological stress on gene expression in the mouse rectum.
GSE11911	Gene expression profiling of experimental asthma reveals a possible role of paraoxonase-1 in asthma
GSE11933	Gene expression changes in femur bone induced by skeletal muscle unloading
GSE11978	Gene expression profiling of peripheral blood and alveolar recruited mononuclear phagocytes in Pam3CSK4 treated mice
GSE12008	Identification of LMX1B target genes in a tet-off inducible HeLa cell line and in the mouse kidney
GSE12111	IKKα Is Required to Maintain Skin Homeostasis and Prevent Skin Cancer
GSE12158	Murine spleen B cells miR181b vs control (G4122F)
GSE12186	microRNA expression profile of activated primary B cells and miR181b overexpressing primary B cells
GSE13237	Effect of DEHP on adult mouse Sertoli cells rich areas (SCRA)
GSE13240	Effect of DEHP on adult mouse Leydig cells
GSE13241	Effect of DEHP on adult mouse
GSE13312	Role of p53 in mouse iPS cell generation
GSE13365	Effect of p53 on iPS cell generation
GSE13558	Lung Trafficking of Macrophages
GSE13686	Regulation of lymphoid versus myeloid fate choice by Mef2c
GSE14201	Transcription factor Achaete scute-like 2 (Ascl2) controls intestinal stem cell fate
GSE14418	The effect of TIM-3 stimulation on the gene expression profile of B16-F10 melanoma cells
GSE14438	The effect of TIM-3 stimulation on the gene expression profile of IgE/antigen-activated mouse mast cells
GSE14549	Gene expression profiling in liver of mice with a mutant Wrn protein treated with/without vitamin C compared to WT mice.
GSE14715	Phosphorylation of MeCP2 at Serine 80 regulates its chromatin association and neurological function
GSE14892	The Ets domain transcription factor Spdef drives maturation of Goblet and Paneth cells in the intestinal epithelium
GSE15107	R1 mESC Exposed to Butyrate
GSE15112	ESC Exposed to Butyrate
GSE15263	Expression of autotaxin and lysophosphatidic acid receptors increases mammary tumorigenesis, invasion, and metastases
GSE15603	Metastable pluripotent states in NOD mouse derived ES cells
GSE15632	Gene expression profiling of Stat3flx/flx/NIC breast tumors compared to wild type NIC tumors.
GSE15775	Generation of induced pluripotent stem cells by efficient reprogramming of adult bone marrow cells
GSE15798	Regulation of the anti-immune response by Chlorella intake during swimming stress in mice
GSE15860	Caloric restriction modified anxiety- and depressive-like behavior and gene expression change in the mouse amygdala
GSE16021	The difference of gene expression for live or dead BbrY associated mice.
GSE16106	PKGI KO vs. WT brown adipocytes and brown adipose tissues
GSE16145	Expression analysis of resting and stimulated naïve and MP CD8 T cells
GSE16180	Bone-marrow derived macrophages response to the Whipple's disease agent, Tropheryma whipplei
GSE16739	Murine Back Skin: Control vs. Cyclosporin A-treated
GSE16917	Strain differences in e11.5 XY gonad transcriptome suggest a mechanism for the sensitivity of C57BL/6J to sex reversal
GSE17166	Eos mediates Foxp3-dependent gene silencing in CD4+ regulatory T cells
GSE17178	Wild-type p53 enhances efficiency of simian virus 40 large-T-antigen-induced cellular transformation
GSE17231	Influence of MLL/ENL expression on murine bone marrow cells with a conditional Mef2c knockout or a Mef2c rescue
GSE17268	Polidocanol injury wildtype versus Myd88 KO trachea
GSE17345	Analysis of temporal mRNA expression changes in cultured keratinocytes from Casp-8F/–K5-Cre and Casp-8F/+K5-Cre mice
GSE17365	Analysis of mRNA expression differences in the skin of Casp-8F/–K5-Cre and Casp-8F/+K5-Cre mice
GSE17423	Age-related para-inflammation in the neuroretina of the mouse
GSE17432	Murine Embryonic Fibroblasts: Wild-type Stmn1 versus null Stmn1 Cells
GSE17446	Differential Expression Studies in Murine Splenic Cells During Prion Infection
GSE17485	Active Lgr5 Positive Stem Cells Drive Self-Renewal in the Pyloric Stomach and Efficiently Build Pyloric Units In-vitro
GSE17644	Sex-specific early growth hormone responses in mouse liver (Mus musculus)
GSE17658	Cdx and Hox genes differentially regulate posterior axial growth in mammalian embryos - 5/6 somites embryonic stage
GSE17663	Cdx and Hox genes differentially regulate posterior axial growth in mammalian embryos
GSE17759	The Involvement of mir-146 in Microglial Cells (EOC 13.31) During Prion Disease
GSE17901	Abdominal Aortic Aneurysm in the ApoE Knockout Mouse: Time Course of Control vs. Angiotensin II
GSE17973	Murine 3T3-L1 adipocytes vs. adipocyte-derived microvesicles (ADMs)
GSE18168	Uterine gene profiles from WT, KIKO (DNA-binding deficient ERα) and aERKO mice treated with estradiol or xenoestrogens
GSE18258	Global analysis of H3K4 methylation
GSE18261	Expression analysis on Mll1+/+ and Mll1-/- MEFs
GSE18319	Gene expression signatures for mESC treated by RNAi strategy on down regulation of gene Mtf2
GSE18524	Identification of the Early VIP Transriptome and its Associated Interactome in Resting Murine CD4 T Cells
GSE18525	Identification of the Early VIP Transriptome and its Associated Interactome in Activated Murine CD4 T Cells
GSE18526	Identification of the Early VIP Transriptome and its Associated Interactome in Resting and Activated Murine CD4 T Cells
GSE18604	Comparison of gene expression in mouse placentas with different combination of MT1-MMP and MT2-MMP alleles
GSE18664	Down-regulation of JunB by RNAi in mouse muscles in vivo
GSE18702	Murine Fgf3-/-;Fgf10-/- vs. Fgf3+/-;Fgf10+/- otic placode profiling
GSE18727	Gene expression profile of bone marrow with post-irradiation radioprotector
GSE18789	mRNA expression profiling in adult mouse liver following benzo(a)pyrene (BaP) treatment [Agilent gene expression array]
GSE18841	Adult mouse liver following benzo(a)pyrene (BaP) treatment: miRNA and mRNa profiling
GSE18996	ShcA is a Paracrine Integrator of the Adaptive Immune Response during Breast Cancer Progression
GSE19174	PARP1 and Salmonella
GSE19214	Serotonin stimulation of alveolar macrophages from wild type and 5-HT2C deficient animals
GSE19329	Transcriptome analysis of testicular cells in wild type (VRK1+/+) and mutant (VRK1-/-) Mus musculus
GSE19487	Lungs of mice exposed to subtoxic doses of nano-titanium dioxide particles by inhalation
GSE19522	Deficient of IL-18 in mice leads to the reduction of neuropeptides in the amygdala related with behavioral change
GSE19581	Mouse embryonic kidneys (E13.5): HDAC inhibitor (HDACi) treated vs. Control
GSE19598	CTL differentiation: WT vs. IL-2Ra deficient CTL
GSE19631	Global changes in gene expression in response to miR-200 overexpression in 4TO7 cells
GSE19904	Tumor-specific CD4+ T cells eradicate established melanoma
GSE19928	Effect of Malat1 ASO on Neuro2 neuroblastoma cells transcriptome
GSE20147	Profiling of cutaneous tumors
GSE20178	Gene expression profile of oxidative stress-inducible genes of murine embryonic fibroblasts (MEFs)
GSE20207	Wild-type bone-marrow derived macrophages response to Escherichia coli lipopolysaccharide (LPS)
GSE20208	Interleukin-16-knock-out bone-marrow derived macrophages response to Escherichia coli lipopolysaccharide (LPS)
GSE20209	Interleukin-16-knock-out bone-marrow derived macrophages response to the Whipple's disease agent, Tropheryma whipplei
GSE20210	Role of interleukin-16 in macrophage responses to Tropheryma whipplei and lipopolysaccharide
GSE20269	Lgr6 Marks Stem Cells in the Hair Follicle that Generate all Cell Lineages of the Skin
GSE20270	Altered gene expression is associated with age-dependent memory impairment
GSE20415	Gene expression profiles in livers caused by Atg7 and/or Nrf2 deficiency
GSE20450	Microarray analysis in Npc1-/- mouse cerebellum
GSE20517	Tumor-derived Jagged1- and Notch-dependent transcription changes in MC3T3-E1 osteoblasts
GSE20625	Impact of MAA on mouse Leydig cell gene expression (Mus musculus)
GSE20661	Transactivation of the dopamine receptor 3 gene results in development of B-cell lymphoma in mice
GSE20949	Gene expression in mice brain after ciguatoxin exposure
GSE20959	Gene expression profiles of irradiated lung tissue in three mouse strains
GSE21065	Sex-related differences in gene expression following Coxiella burnetii infection: potential role of circadian rhythm
GSE21157	Adipocyte differentiation with or without Bilberry and anthocyanidins
GSE21208	Gene expression profiling of neural stem cells and their neuronal progeny reveals IGF2 as a regulator of adult hippocampal neurogenesis
GSE21277	The role of microRNAs in hepatic thyroid hormone signalling
GSE21307	Characterization of Directly Regulated Thyroid Hormone Mediated Gene Expression Following Short-Term Perturbations in Thyroid Hormone Levels in Juvenile Mice
GSE21431	Differential expression of genes in liver of mice with a nonfunctional helicase domain of the Wrn protein treated with resveratrol compared to untreated wild type mice.
GSE21454	Gene expression analysis of fetal liver pro-B cells upon deletion of Early B-cell Factor 1 (Ebf1)
GSE21455	Gene expression analysis after reconstitution of Ebf1-deficient pre-pro-B cells with Ebf1
GSE21608	Cell-Type-Specific TGF-beta Signaling is Targeted to Genes that Control Cell Identity: Gene Expression
GSE21621	Cell-Type-Specific TGF-beta Signaling is Targeted to Genes that Control Cell Identity
GSE21797	Control of oligodendroglial cell number by the miR-17~92 family of miRNA cluster (mRNA profiling)
GSE21801	Control of oligodendroglial cell number by the miR-17~92 family of miRNA cluster
GSE21845	Comparison of murine colonic mucosal DNA between postnatal day 90 C57BL/6 wild type (WT) and their toll-like receptor 2 knockout (Tlr2-/-) counterparts by methylation specific amplification microarray (MSAM), and whole genomic gene expression profiling
GSE21853	Gene expression analysis of IL-4 primed bone marrow macrophages isolated from Irf4-deficient or heterozygous mice
GSE21855	Elucidation of the expression profile of independent clones of mutant mtBALB and wild type control mtB6 murine cybrid cells
GSE21903	Nuclear orphan receptor TAK1/TR4-deficient mice are protected against obesity-linked inflammation, hepatic steatosis, and insulin resistance
GSE22327	Mouse ES cells vs. iPS cells
GSE22473	Murine postnatal subventricular zone (SVZ) neural stem cells (NSCs): Wild-type (WT) vs. Dnmt3a-null (KO)
GSE22476	Dnmt3a-dependent non-promoter DNA methylation facilitates transcription of neurogenic genes
GSE22556	Control of Embryonic Stem Cell State by Mediator and Cohesin (Agilent gene expression data)
GSE22557	Control of Embryonic Stem Cell State by Mediator and Cohesin
GSE22674	Gene expression profiling in VRK1-deficient testis of Mus musculus
GSE22777	Autocrine IL-1α mediates NF-κB activation by oncogenic ras in keratinocytes
GSE22802	Murine bone marrow immature B cells: autoreactive versus non-autoreactive
GSE22893	Fgf8 E18.5 hypomorph versus control mouse fetal lungs
GSE23064	Murine hamatopoietic stem cell (HSC): wild type and Skp2 knockout
GSE23072	Estrogen response uterine gene profile in Ex3αERKO
GSE23241	Uterine Gene Profile of Estriol, a Weak Estrogen
GSE23456	GIF-5 mouse gastric epithelial cells: CD-133-positive vs CD-133-negative
GSE23635	Conversion of mouse fibroblast to hepatocyte-like cells by defined factors
GSE23639	Transcriptomic definition of curcumin treated microglia
GSE23654	Somatic cell nuclear reprogramming by mouse oocytes endures beyond reproductive decline
GSE23672	COMPARATIVE TRANSCRIPTOMIC AND PROTEOMIC ANALYSIS OF LGR5+ve STEM CELLS AND THEIR DAUGHTERS (AGILENT ARRAYS)
GSE23736	Nuclear receptor, RORa plays a critical role in obesity-associated inflammation, hepatic steatosis, and insulin resistance
GSE23749	Comparison of Gene expression pattern between heat-killed M.leprae and live M. leprae-infected peritoneal macrophage in vivo model
GSE23907	Histone H3K27ac separates active from poised enhancers and predicts developmental state (gene expression data)
GSE23962	Transgenic SCLC induced by E6/E7 oncoproteins vs normal controls
GSE24096	Gene expression profile in the livers of insulin-resistant mice treated with all-trans retinoic acid
GSE24122	Mouse embryo heart, e10.5 AVC: Control vs. Tbx3 hypomorphic mutant
GSE24165	Histone H3K27ac separates active from poised enhancers and predicts developmental state
GSE24208	Reprogramming of fibroblasts into induced pluripotent stem cells with Bmi1
GSE24219	Evaluation of the effects of Lactobacillus sp. (ostrich) on body weight, the intestinal microbiome and metabolism in mice
GSE24256	Liver gene expression analysis of male and female C57BL/6 mice treated with glucocorticoid.
GSE24333	Expression data from ETO2 knockdown G1E-ER-GATA-1 cells
GSE24336	Expression data from LMO2 knockdown G1E-ER-GATA-1 cells
GSE24354	Comparison of murine colonic mucosal gene expression between offspring born to mothers fed a methyl donor diet (MD) versus control at postnatal day 90 (P90).
GSE24359	Expression data from ETO2/LMO2 knockdown G1E-ER-GATA-1 cells
GSE24525	Potential mechanisms of endocrine disruptors as revealed by uterine gene profile
GSE24751	Pulmonary gene and microRNA expression changes in mice exposed to benzo(a)pyrene by oral gavage
GSE24907	Lack of hepatic response of microRNA in mice following chronic benzo(a)pyrene exposure (gene expression)
GSE24910	Lack of hepatic response of microRNA in mice following chronic benzo(a)pyrene exposure
GSE24932	Intact ureteric buds gene expression with AngII treatment
GSE25079	Epistasis analysis of Runx1 and Gata1 over HoxA3 in hemogenic endothelium
GSE25096	HoxA3 is an apical regulator of hemogenic endothelium
GSE25109	Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts
GSE25331	Initiation Pausing of 80S Ribosome on mRNA Is Governed by 5’UTR and Responsive to mTORC1 Signaling (Microarray)
GSE25615	Murine Prostate Tissue: Rb1 null vs. Rb1 E2F binding deficient mutant
GSE25627	Initiation Pausing of 80S Ribosome on mRNA Is Governed by 5’UTR and Responsive to mTORC1 Signaling
GSE26743	An ENU-induced point mutation in the mouse Btaf1 gene causes post-gastrulation embryonic lethality and protein instability
GSE26788	E47 KO versus WT HSCs
GSE26814	Isolation of epiblast stem cells from pre-implantation mouse embryos
GSE26913	Mamld1 knockdown with siRNA in mouse Leydig tumor cells
GSE27035	Global profiling of gene expression in mouse astrocyte in response to the potential longevity determinant miR-29
GSE27101	Comparative oncogenomics identifies breast tumors enriched in functional tumor initiating cells
GSE27271	Adipose tissue analysis of wild-type and beta-carotene 15-15'-oxygenase 1 (Bcmo1) ko mice fed under control diet and beta-carotene diet
GSE27294	The effect of HP1-gamma deficiency on primordial germ cells
GSE27410	Complex modulation of androgen responsive gene expression by methoxyacetic acid
GSE27472	Gene expression profiles of NIH3T3 influenced by MARVELD1
GSE27478	Gene expression differences between the pancreatic tissues of Pdx1-Cre;KrasLSL-G12D and Pdx1-Cre;KrasLSL-G12D;IKK2/betaF/F mice
GSE27639	Neonatal genistein and pregnancy day 2 oviduct gene expression
GSE27684	The effects of kiwifruit extracts on colonic gene and protein expression levels in interleukin 10 gene-deficient mice.
GSE27703	Analysis of the host microRNA response to Salmonella uncovers the control of major cytokines by the let-7 family
GSE27714	Enhancer Decommissioning by LSD1 During Embryonic Stem Cell Differentiation (expression)
GSE27844	Enhancer Decommissioning by LSD1 During Embryonic Stem Cell Differentiation
GSE27883	MAP3K4/CBP Regulated H2B acetylation Controls Epithelial-Mesenchymal Transition in Trophoblast Stem Cells
GSE27885	Transcription profile of B cells isolated from peripheral lymph nodes of wild-type vs CCR7-/- mice
GSE28175	Seeking Gene Candidates Responsible for Developmental Origins of Health and Disease (DOHaD)
GSE28176	Alteration of gene expression patterns in the liver and spleen following exposure to nucleoprotein diet in the mouse LPS injection model
GSE28201	DNA Microarray Analysis Approach for Unraveling the Ischemic Mouse Brain Transcriptome
GSE28265	Lgr4/5/6 family members reside in Frizzled-Lrp complexes and mediate signaling by the Wnt agonist Rspondin1
GSE28410	Mouse oocytes: High hydrostatic pressure (HP) treated vs. Control
GSE28411	Mouse in vitro fertilized four-cell stage embryos: High hydrostatic pressure (HP) treated vs. Control
GSE28443	Mouse oocytes and in vitro fertilized four-cell stage embryos: High hydrostatic pressure (HP) treated vs. Control
GSE28465	Effects of overexpression of Sox2 on gene expression in adult mouse intestine
GSE28505	Comparative global gene expression profiling of mice liver and spleen fed with nucleoprotein (NP) diets
GSE28527	Transcriptome of globus pallidus from a mouse having a low score of cocaine-dependent conditioned place preference
GSE28528	Transcriptome of globus pallidus from a mouse having a high score of cocaine-dependent conditioned place preference
GSE28589	Deletion of astroglial Dicer causes cell non-autonomous neuronal dysfunction and degeneration
GSE28669	Identification of Sox9-Regulated Pathways During Early Pancreas Organogenesis
GSE28671	Identification of Sox9-Regulated Pathways During Pancreas Development
GSE28828	Transcriptomes of subthalamic nuclei, globus pallidus, and accumbens nuclei from mice with low and high scores of cocaine-dependent conditioned place preference
GSE28890	Foxl1-Cre-marked Adult Hepatic Progenitors Have Clonogenic and Bi-Lineage Differentiation Potential - Time Course
GSE28892	Foxl1-Cre-marked Adult Hepatic Progenitors Have Clonogenic and Bi-Lineage Differentiation Potential
GSE29042	Expression profiling of mice exposed to multiwalled carbon nanotubes
GSE29067	Maternal inhalation of surface-coated nano-sized titanium dioxide (UV-Titan): Effects in prenatally exposed offspring on hepatic DNA damage and gene expression
GSE29121	Prospective isolation of a bipotential clonogenic liver progenitor cell in adult mice
GSE29139	Identification of response genes upon neuronal activation in mouse cortical neurons
GSE29140	An extreme human-specific delay in cortical synaptic development
GSE29388	H. pylori infection blocks DNA damage induced apoptosis by T4SS-dependent upregulation of miR-155
GSE29546	FGF18 affects hair cycle.
GSE29547	Fgf18 regulates hair cycle
GSE29558	Comparison of gene expression profiles of MafF-/-: MafG-/-: MafK-/- embryos and MafF-/-: MafG+/+: MafK-/- embyos
GSE29607	Comparison of gene expression profiles of effector T cells from leptin-receptor-deficient mice and wild type mice
GSE29608	Gene expression profiles of effector T cells
GSE29694	Compare gene expression patterns in Chsy-1 wt and ko mouse 13.5 days embryo forelimbs
GSE29724	Unsupervised hierarchical clustering of iNPCs induced by 6 or 5 TFs
GSE29726	The overexpression of Pax6 affects mesenchymal to epithelial transition (MET) pathway during iPS induction in NPC.
GSE29728	Overexpression of each of the 6 interfering TFs and 5 non-interfering TFs
GSE29729	Selection of NPC specific Transcription factors
GSE29730	Unsupervised hierarchical clustering of iHPCs induced by 9 or 10 TFs
GSE29761	Exposure of pregnant mice to carbon black by intratracheal instillation: toxicogenomics effects in dams and offspring (dams samples)
GSE29762	Exposure of pregnant mice to carbon black by intratracheal instillation: toxicogenomics effects in dams and offspring (offspring samples)
GSE29764	Exposure of pregnant mice to carbon black by intratracheal instillation: toxicogenomics effects in dams and offspring
GSE29777	Gene expression profiling of small intestine (SI) NKp46+RORgt+ and NKp46+RORgt- Innate Lymphoid Cells (ILCs)
GSE29875	Systematic identification of transcription factors capable of inducing cell-type-specific transcriptional profiles
GSE29878	Sequential Reprogramming Leads to a Specific Hepatic Expression Pattern during Mouse Bone Marrow Derived Hepatocyte Formation In Vivo
GSE30084	Expression levels of xenobiotic transporters in kideny of Abcb4-null mice
GSE30113	Concerted involvement of Cdx/Hox genes and Wnt signalling in morphogenesis of the caudal neural tube and cloacal derivatives from the posterior growth zone.
GSE30196	Comparison of gene expression in mouse CD4 naïve and activated T-cells
GSE30306	Gene expression of murine STAT3-KO hearts vs WT
GSE30349	Expression profiling of immortalized mature, murine T cells
GSE30523	Tregs from Bcl11b-deficient versus wild type Tregs (CD4Cre and Foxp3Cre systems)
GSE30629	Gene expression profile of isolated splenic NK cells from mice treated with ptaquiloside and/or selenium
GSE30638	Attenuation of early atherogenesis in LDLR-KO mice by proteasome inhibition
GSE30748	Gene expression profile of Tet1 knockout mouse embryonic stem cells (mESCs)
GSE30771	MiR-150 Suppresses MLL-AF9 Associated Leukemia Through Simultaneously Targeting Multiple Oncogenes
GSE30773	Ctnnb1-targeted genes in mouse post-meiotic germ cells
GSE30791	A supporting environment for hematopoietic stem/progenitor cells is maintained by canonical Wnt signaling
GSE30840	Gene expression profiles of LPS-stimulated RAW264.7 macrophages overexpressing Tbc1d23 novel innate immune gene
GSE30965	Differentiation related tumorigenic potential and transcriptional profile of the fusion reprogrammed mouse cancer cell lines
GSE31063	Extinction learning
GSE31533	A CDK-independent function of p27kip1 in the control of cell proliferation
GSE32028	Mouse Placenta:Maternal experimental UTI vs Sham UTI infected
GSE32059	Loss of Pim1 Imposes a Hyperadhesive Phenotype on Endothelial Cells
GSE32210	In vitro expansion of single adult Lgr5+ liver cells induced by Wnt-driven regeneration
GSE32230	A defect of the INK4-Cdk4 checkpoint and c-myc collaborate in blastoid mantle cell lymphoma (MCL)-like lymphoma formation in mice
GSE32244	Foxa1 and Foxa2 are Required for Sexual Dimorphism in Liver Cancer - Gene Expression
GSE33138	Gene expression of Tg 3×FLAG-Nanos2-deltaN10 mouse male gonad
GSE33263	IM001: Influenza A/VN/1203/04 infection of C57Bl/6 mouse model - Data from 3 viral doses at 1, 2, 4 and 7 days post infection
GSE33266	SM001: SARS CoV MA15 infection of C57Bl/6 mouse model – Data from 4 viral doses at 1, 2, 4 and 7 days post infection.
GSE33323	Kras-induced ikk2/nf-kappaB activation by IL-1 alpha and p62 freedforward loops is required for development of pancreatic ductal adenocarcinoma
GSE33560	Expression profiling of Notch constitutive activation in the liver of mice
GSE33608	Histone Deacetylase 3 is an Epigenomic Brake in Macrophage Alternative Activation (microarray)
GSE33609	Histone Deacetylase 3 is an Epigenomic Brake in Macropahge Alternative Activation
GSE33663	Environmental pollution assessment using Mus spretus
GSE33949	COMPARATIVE TRANSCRIPTOMIC AND PROTEOMIC ANALYSIS OF LGR5+ve STEM CELLS AND THEIR DAUGHTERS
GSE33974	Effect of Pnpla6 gene silencing in D3 mouse embryonic stem cells
GSE34067	Gene expression profiles of Notch signaling suppression in prostate basal cells.
GSE34210	Bone marrow-induced Mef2c deficiency delays B cell development and alters the expression of key B cell regulatory proteins
GSE34442	The Autonomous Hepatocyte Clock Controls Acetaminophen Bioactivation and Chronotoxicity [Liver]
GSE34443	The Autonomous Hepatocyte Clock Controls Acetaminophen Bioactivation and Chronotoxicity [Kidney]
GSE34444	The Autonomous Hepatocyte Clock Controls Acetaminophen Bioactivation and Chronotoxicity
GSE34530	Early Mechanisms of Pathobiology are Revealed by Transcriptional Temporal Dynamics in Hippocampal CA1 Neurons of Prion Infected Mice
GSE34625	Genetic ablation of Rest leads to in vitro-specific derepression of neuronal genes during neurogenesis
GSE34758	Stage-dependent gene expression change in Sertoli cells regulated by retinoic acid signaling
GSE35124	Comparison of gene expression profiles among Nrf1 liver-specific conditional knockout, Nrf2 knockout and Keap1 knockdown mice.
GSE35188	DIMETHYLBENZANTHRACENE (DMBA) INDUCED MAMMARY CARCINOGENESIS IN MMTV-Neu and MMTV/p53 KO FEMALE MICE AND EFFECTS OF REXINOIDS
GSE35192	Hepatic gene expression in C57BL/6 mice intratracheally instilled with Printex 90 carbon black nanoparticles
GSE35193	Pulmonary gene expression in C57BL/6 mice intratracheally instilled with Printex 90 carbon black nanoparticles
GSE35284	Gene expression in C57BL/6 mice intratracheally instilled with Printex 90 carbon black nanoparticles
GSE35419	Sox9 mediated differential gene expression was assessed in prostaspheres derived from urogenital sinus epithelial cells
GSE35432	Mouse embryonic kidneys (E13.5): mutant (UB HDAC1,2-/-) vs. wild type
GSE35596	Age-dependent gene expression in isolated small intestinal epithelial cells (IECs)
GSE35597	Microbiota-dependent gene expression in small intestinal epithelial cells (IECs)
GSE35645	Comparison of gene expression profiles of p45-/- primary megakaryocytes and WT primary megakaryocytes
GSE35669	Global comparative transcriptome analysis of cartilage formation in vivo
GSE35718	Pulmonary gene expression in MutaTMMouse orally gavaged with three doses of benzo(a)pyrene and vehicle control
GSE35897	Impact of Cux2 overexpression on gene expression in male and female mouse liver (Mus musculus)
GSE36136	Expression profiling of the E10.5 cardiac conduction system using MinKGFP BAC transgenic mice
GSE36206	Translatome of NIH3T3 cells: control vs. stress treatment
GSE36307	Gene expression in liver of wild-type and Dicer1-KO mice treated with genotoxic carcinogen N-ethyl-N-nitrosourea
GSE36312	control vs. Th3 beta thalassemia kidney
GSE36443	Parallel selection mapping using artificially selected mice reveals body weight control loci (gene expression)
GSE36452	Parallel selection mapping using artificially selected mice reveals body weight control loci
GSE36496	Murine Kidney Tissue: Unilateral ureteral obstructed mice vs. Sham control
GSE36497	Gene expression profiling along the intestinal crypt axis.
GSE36508	Gene Expression in the Lrrc10 knockout heart
GSE36571	Analysis of SAMP8 and SAMR1 mice after an exercise intervention
GSE36662	Expression profiles in the complete absence of DNA methylation [Agilent-014868]
GSE36702	Complete absence of DNA methylation effect on histone modifications H3K4me2, H3K27me3 and H3K9me2
GSE36716	Muscle Involvement in Preservation of Metabolic Flexibility by Treatment using n-3 PUFA or Rosiglitazone in Dietary-Obese Mice
GSE36717	Muscle Involvement in Preservation of Metabolic Flexibility by a Combination Treatment using n-3 PUFA and Rosiglitazone in Dietary-Obese Mice
GSE36718	Muscle Involvement in Preservation of Metabolic Flexibility by Treatment using n-3 PUFA, Rosiglitazone, and a combination of both
GSE36875	Transcriptome Alteration in the Diabetic Heart by Rosiglitazone: Implications for Cardiovascular Mortality
GSE37078	Impact of Cux2 knockdown on gene expression in female mouse liver (Mus musculus)
GSE37287	Gene expression analysis of developing limbs
GSE37471	Role of Estrogen Receptor α in Mouse Oviduct Gene Expression
GSE37515	Gene expression signatures for fractions of E7.5 whole embryos based on Endoglin and Flk-1 markers
GSE37565	Transcriptomics and Proteomics Analyses of the PACAP38 influenced Ischemic Brain in Permanent Middle Cerebral Artery Occlusion Model Mice
GSE37828	Silencing of Irf7 pathways in breast cancer cells promotes bone metastasis through immune escape mechanisms
GSE37871	Expression profiling in primary embryonic fibroblasts deficient for the N-terminal truncation of Lats1
GSE37885	Cardiac gene expression (random section containing both ventricles) in C57BL/6 mice intratracheally instilled with Printex 90 carbon black nanoparticles (set 1)
GSE37891	Cardiac gene and miRNA expression (random section containing both ventricles) in C57BL/6 mice intratracheally instilled with Printex 90 carbon black nanoparticles
GSE37915	Predicting drug responsiveness in humans cancers using genetically engineered mice
GSE37926	Gene expression profiling of Lgr5 positive cells within intestinal adenomas
GSE37928	Comparison of gene expression patterns between Lgr5 positive cells in adenomas and small intestine
GSE37929	Expression profiling of Lgr5 positive adenoma cells.
GSE37953	E.coli Infected Bladder Samples (PBS, WT and all mutants)
GSE37959	E.coli Infected Bladder Samples (PBS, WT and 2 mutants)
GSE38025	Gene Expression in Postnatal Mouse Kidney Development
GSE38035	Dnmt3a regulates both cell proliferation and differentiation of mouse neural stem cells
GSE38117	Exploring new pathways involved during experimental renal fibrogenesis in the Unilateral Ureteral Obstruction
GSE38336	Gene expression signatures of Meis1 conditional knockout hematopoietic stem cells
GSE38350	Expression data in Hepa1c1c7 cells treated with Nrf2 activator, diethyl maleate (DEM)
GSE38365	Targeted disruption of BMAL1 in the peripheral reproductive axis results in infertility in female mice.
GSE38420	Tumor suppressor p53 integrates host defense and cell fate during bacterial pneumonia
GSE38465	Analysis of brain cortices of SAMP8 and SAMR1 mice after an exercise intervention
GSE38704	Regulation of gene expression by RORgamma in Th17 cells
GSE38753	Differentiating Mouse Colon and Rectum: Transcriptional Differences and Environmental Exposure
GSE38785	Peyer’s Patch M cells derive from Lgr5+ stem cells require SpiB and are induced by RankL in cultured ‘organoids’
GSE38800	The transcriptional response of mouse uterus to estrogen is genetically regulated
GSE38801	Essential roles for chromatin protein L3mbtl2 in pluripotent stem cells
GSE38976	Gene expression profiles of whole blood cells and the fraction enriched with tumor-infiltrating inflammatory cells of Balb/c athymic mice with Hepa1-6 tumors
GSE38979	Gene expression profiles of blood and the enriched fraction of tumor-infiltrating inflammatory cells of C57Bl/6 mice with Hepa1-6 tumors
GSE38980	Gene expression profiles of whole blood cells of C57Bl/6 mice with Hepa1-6 tumors
GSE38981	Gene expression profiles of Hepa1-6 tumors in C57Bl/6 mice
GSE39075	Gene expression analysis of blood cells and tumor
GSE39140	Quercetin induces hepatic lipid omega-oxidation and lowers serum lipid levels in mice
GSE39163	MicroRNA miR-223 constrains lethal inflammation during Mycobacterium tuberculosis infection
GSE39213	Gene expression profiles in the adult liver, fetal liver and bone marrow
GSE39535	An RNA-interacting protein network regulates pluripotency in mammalian primordial germ cells (Dazl knockdown)
GSE39541	An RNA-interacting protein network regulates pluripotency in mammalian primordial germ cells (Dazl UV RNA-IP)
GSE39544	An RNA-interacting protein network regulates pluripotency in mammalian primordial germ cells (Dazl native RNA-IP)
GSE39545	An RNA-interacting protein network regulates pluripotency in mammalian primordial germ cells (Dazl testis RNA-IP)
GSE39546	An RNA-interacting protein network regulates pluripotency in mammalian primordial germ cells (in vitro, in vivo)
GSE39547	An RNA-interacting protein network regulates pluripotency in mammalian primordial germ cells
GSE39563	Membrane Vesicles of a Bacterial Mutualist Mediate Immune Regulation via Dendritic Cells
GSE39573	Gene expression analysis of IL-17 induced mice small intestinal smooth muscle strips with or without 6-shogaol.
GSE39769	Development of gene expression signatures in testis for plin1-null mice
GSE39778	Role of SIRT1 in diet-induced metabolic diseases
GSE39830	Milk- and soy-based diets have differential effects on colitis and colon gene expression in the Il10-/- mouse
GSE39859	Gene expression changes in the microdissected colon epithelium are similar to those of intact colon in the Il10-/- mouse model of IBD
GSE39862	Role of interleukin-4 in the licensing of dendritic cells for the induction of Th2 responses [A]
GSE39863	Role of interleukin-4 in the licensing of dendritic cells for the induction of Th2 responses
GSE39915	Dll1 marks early secretory progenitors in gut crypts that can revert to stem cells upon tissue damage
GSE39934	Knockdown of Hnrnpa0, a del(5q) Gene, Alters Myeloid Cell Fate in Murine Cells
GSE40090	Mouse whole kidney, Dot1lAC vs. Dot1lf/f mice
GSE40395	Stem cell therapy of murine liver cirrhosis
GSE40600	Gene expression in the embryonic Lrrc10 knockout heart
GSE40826	Pathological impact of hepatitis B virus surface proteins on the liver is associated with the host genetic background
GSE41284	Diabetes risk gene and Wnt effector Tcf7l2/TCF4 controls hepatic response to perinatal and adult metabolic demand
GSE41344	Gene expression profiles (stroma and epithelium) of prostate cancer mouse models (JOCK1, Pro-Cat × JOCK1, Ubi-Cat × JOCK1)
GSE41381	Modulation of T cell responses by type I interferons
GSE41465	stem cell therapy of murine acute hepatitis
GSE41601	Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer (mRNA expression data).
GSE41748	Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer
GSE42622	Lactobacillus acidophilus and Helicobacter pylori stimulation of bone marrow derived macrophage
GSE42640	Transcriptomic Classification of Genetically Engineered Mouse Models of Breast Carcinoma Identifies Human Subtype Counterparts
GSE42727	Development of distinct gene expression signature in neurons from different regions of the brain
GSE42820	Gene expression changes resulting from attenuation of Dicer activity
GSE43038	Post-weaning selenium and folate supplementation affects gene and protein expression and global DNA methylation in mice fed high-fat diets
GSE43104	Identification of CD44 downstream target genes
GSE43465	Effect of dietary vitamin B6 on white adipose tissue
GSE44287	Master Transcription Factors and Mediator Establish Super-Enhancers at Key Cell Identity Genes [gene expression]
GSE44288	Master Transcription Factors and Mediator Establish Super-Enhancers at Key Cell Identity Genes
GSE44848	Type I IFN signaling promotes local inflammation in pulmonary tuberculosis
GSE45793	Differential gene expression in cartilage from the mouse DMM osteoarthritis model
GSE46048	High expression genes in urethane-induced lung tumor
GSE46421	Lung conventional dendritic cells promote mucosal adjuvant activity of flagellin
GSE46695	Inhibition of astroglial NF-kB regulates oligogenesis following spinal cord injury.
GSE46948	Global Gene Expression of hematopoietic stem cells expressing endogenous NrasG12D/G12D, NrasG12D/+, Nras+/+
GSE47587	Expression profile of cortices, hippocampi and brainstems of Nrf2 knockout mice under unstressed conditions
GSE47905	Murine E9.5 embryo PSM and newly formed somites: Paraxis-/- vs WT
GSE48130	Aryl hydrocarbon receptor senses bacterial pigmented virulence factors and orchestrates anti-bacterial defenses (part 1)
GSE48133	Aryl hydrocarbon receptor senses bacterial pigmented virulence factors and orchestrates anti-bacterial defenses
GSE48411	Reprogramming of mouse somatic cells into pluripotent stem cells using a combination of small molecules
GSE48682	ASC deficiency suppresses proliferation and prevents medulloblastoma incidence
GSE48683	Interferon-gamma protects sympathetic neurons from apoptosis at the point of cytochrome c release
GSE48827	Structural basis of a novel Interferon b signaling axis mediated via the ifnar1 receptor
GSE49115	Mice cerbellum extracts: SCA7 KI mice vs. wild type mice
GSE49169	miR expression profiling of mouse hematopoietic stem and progenitor populations [mRNA]
GSE49170	miR expression profiling of mouse hematopoietic stem and progenitor populations
GSE49250	INO80 complex in the core regulatory network governing ESC self-renewal [771_timecourse]
GSE49251	INO80 complex in the core regulatory network governing ESC self-renewal [728_subunits]
GSE49252	INO80 complex in the core regulatory network governing ESC self-renewal
GSE49707	Sexual dimorphisms in zonal gene expression in mouse liver
GSE49878	Gene expression of p53 null vs. p53 wild-type mouse kidneys at embryonic day 15.5
GSE49948	Eimeria falciformis infection of the mouse caecum identifies opposing roles of IFNg-regulated host pathways for the parasite development
GSE49964	Seeking genes responsible for developmental origins of health and disease from the fetal mouse liver following maternal food restriction [Expression]
GSE50103	Unlimited in vitro expansion of adult bi-potent pancreas progenitors through the Lgr5/Rspondin axis
GSE50575	Comparison of gene expression profiles of Pten, Keap1 and Nrf2 knockout mouse livers.
GSE50578	Global microarray analysis of changes of gene expression in the epidermis of K14-caSmad1 mice
GSE50795	Effect of Sunitinib treatment withdrawal on Immunodeficient mice bearing MDA-MB231 tumors
GSE50869	Different developmental trajectories of ovaries in Siberian hamsters raised in long and short day lengths
GSE51040	Host miRNA molecular signatures in the brains of mice are associated with acute herpes simplex virus 1 encephalitis
GSE51269	Homeostatic intestinal epithelial gene expression
GSE51496	The THO complex regulates pluripotency gene mRNA export to control embryonic stem cell self-renewal and somatic cell reprogramming (microarray)
GSE51534	The THO complex regulates pluripotency gene mRNA export to control embryonic stem cell self-renewal and somatic cell reprogramming
GSE51539	Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny
GSE52053	Murine host body reactions to implanted scaffolds: non-coat polystyrene scaffold vs. collagen- or PMB-coated scaffold
GSE52106	Hes1 and Liver Glucocorticoid Signaling
GSE52448	Gene expression change in Gata2 conditional knockout mice adult renal collecting duct
GSE52518	Seeking genes responsible for developmental origins of health and disease from the fetal mouse liver following maternal food restriction
GSE52784	HES1 Is a Master Regulator of Glucocorticoid Receptor-Dependent Gene Expression
GSE53036	Gene expression profiling of mouse prostate over-expressing the Notch1 intracellular domain.
GSE53812	Uterine Epithelial Cells Specific Estrogen Receptor alpha-Dependent Gene Expression Profiles in Response to Estrogen
GSE53910	C57BL6/J livers exposed to low fat and high fat diet, wild-type vs Cyp1b1 null
GSE54071	Mouse liver: Control versus IL1-beta challenge, male and female
GSE54155	Evaluation of lipin-1 effects on gene expression during TLR4 stimulation of macrophages
GSE54457	Expression profiling of mouse fetal liver late erythroblasts after knockdown of Xpo7
GSE54642	Histone deacetylase inhibition replicates aspects of the adaptive response to exercise and improves muscle metabolism and cardiac function in obesity.
GSE54718	Characterization of 5-aminolevulinic acid effects on radiotherapy using mouse tumor model.
GSE54804	Expression profiling of Mammary Gland Tumor epithelial cells
GSE55127	Gene expression signature induced by 8 weeks of cigarette smoke exposure in the lung of BALB/c mice
GSE55517	Microarray analysis of gene expression in CD4+CD8+ double pos (DP) thymocytes upon depletion of Ubiquitin specific protease 8
GSE55554	Transcriptional response to stress in serum deprived mouse fibroblasts
GSE55669	Prolactin Prevents Hepatocellular Carcinoma by Restricting Innate Immune Activation of c-Myc in Mice
GSE55784	Genome-wide analysis of stress response in mouse fibroblasts
GSE56038	Gene expression profiles of white adipose tissues from C57BL/6 mice in the effect of high fat diet
GSE56423	Estradiol Induced Transcriptional Profile of EAAE DNA Binding Deficient ERa Uterus
GSE56557	Co-chaperone CCRP/DNAJC7-regulated gene regulation in the mouse liver
GSE56713	Expression profile of bcl11b-deficient cd8 T cells during immune response
GSE56714	Expression profile of bcl11b-/- preselected DP thymocytes
GSE56791	Macrophages recognize the Helicobacter pylori type IV secretion system in the absence of TLR signaling
GSE56925	Expression profile of bcl11b-deficient NAÏVE CD8+ T cells versus wild type
GSE57053	Ascl2 acts as an R-spondin/Wnt responsive switch to control stemness in intestinal crypts [array]
GSE57072	Effect of prolactin and actinomycin D on gene expression in murine AML12 and Hepa 1-6 hepatocytes
GSE57124	Lung-resident myeloid-derived suppressor cells display dual functionality in experimental tuberculosis
GSE57472	Target genes of BRG1 in mouse embryonic stem cells
GSE57474	Target genes of BRG1 in human or mouse embryonic stem cells
GSE58146	M-CSF priming of osteoclast precursors can cause osteoclastogenesis-insensitivity, which can be prevented and overcome on bone
GSE58191	Mice model for 15q11-13 duplication syndrome show late onset obesity and altered lipid metabolism
GSE58275	Liver Transcriptomics data from mouse model with Features of Post-traumatic Stress Disorder
GSE59070	Effect of acute and chronic social stress on hippocampal transcriptome in mice.
GSE59194	Mouse Liver: Tumors vs Two Week Transgene Expression vs Normal
GSE59211	Mouse Liver: Tumors vs livers with transgene turned off for 4 weeks vs livers with transgene turned off for 12 weeks vs Normal
GSE60078	Genetic characterization of p27Kip1 and stathmin role in controlling cell proliferation in vivo
GSE60085	Quantitative omics reveals that type I and II IFNs alter bacterial vacuole compositions to restrict infection in macrophages and lungs
GSE60253	Murine Liver Cells: Control B6 males vs. little (GH-deficient) and Tfm (AR-null) males
GSE60614	Differential gene expression between female hNAG-1 transgenic and Wt mice in abdominal white adipose tissue (WAT)
GSE61416	Microarray analysis of the effects of a γ-tocopherol-rich mixture of tocopherols on global gene expression in the prostates of TRAMP mice
GSE61708	Effect of locally applied enalapril maleate on the gene expression profile in dorsal skin after UVB irradiation
GSE61921	Uterine Transcriptional Profile Following Treatment with Estradiol or Synthetic Estrogens Diethylstilbestrol and Propyl Pyrazole Triol
GSE62197	Enhanced adult hippocampal neurogenesis in mice fed the marine-plant derived astaxanthin supplement: A DNA microarray-based analyses
GSE62531	Hyperosmotic-induced changes in lymphoid cell gene expression
GSE62637	Gene expression profiles of the lung of CD2-T-bet transgenic mice
GSE62884	Unraveling the Specific Ischemic Core and Penumbra Transcriptome in Permanent Middle Cerebral Artery Occlusion Model Mice Brain Treated with Neuropeptide PACAP38
GSE63365	Comparison of gene expression patterns between Lgr5 positive cells and CD24 hi cells in murin colon
GSE63535	Transcriptome profiling of mouse embryonic fibroblasts upon contact inhibition
GSE63536	Transcriptome profiling of Lats2 deficient mouse embryonic fibroblasts
GSE63538	LATS2 regulates repressive epigenetic integrity via regulation of Polycomb repressive complex 2
GSE63730	Murine KN6-Lig+ and Lig- DN4 Cells compared to DN3 cells
GSE63852	Toxicogenomics analysis of placenta samples from mice exposed to different doses of BPA
GSE64939	Polycomb Underlies Transcriptional Heterogeneity in Lineage Priming of Embryonic Stem Cells [gene expression]
GSE65011	Combined inhibition of TGFβ and PDGF signaling attenuates radiation-induced pulmonary fibrosis
GSE65289	Polycomb Underlies Transcriptional Heterogeneity in Lineage Priming of Embryonic Stem Cells
GSE65677	The Six1 oncoprotein represses translation of p53 via concomitant regulation of RPL26 and microRNA-27a
GSE66177	Genomically amplified Akt3 activates DNA repair pathway and promotes glioma progression
GSE66259	Gene expression in mouse DRG neurons at 2 or 5 days post-sciatic lesion in WT and Nfil3-KO
GSE66319	Gene expression profiling on C3H/10T1/2 fibroblasts during their myogenic conversion in case of Six4 ablation
GSE66938	Food protein-induced activation and death of CD4+ Helios+ Foxp3- T cells is required for IL-10 production and intestinal homeostasis
GSE67049	Microarray analysis of skeletal muscle in PGC1α transgenic mice
GSE67204	Comparision of expression profile between CD4+ helper T cells and CD8+ cytotoxic T cells
GSE67238	Glis3 regulates pancreatic beta cells development and maturation
GSE67421	Bioinformatics Analysis of the Permanent Middle Cerebral Artery Occlusion (PMCAO) Mouse Model Brain Regions Gene Profiles for Unraveling Progression of the Ischemic Core
GSE67616	Integrative analysis of the acquisition of pluripotency in PGCs
GSE68179	Gene expression in the liver and colon of mice fed diets HH, LL, HL and LH
GSE68522	Effect of mannose-binding lectin (MBL) on pulmonary gene expression in response to ozone
GSE68678	Transcriptome of mouse epithelial cells
GSE68754	Gene expression profiling of FDCPmix sub-fractions
GSE68773	Global gene expression comparation among testes, ovaries, Smad4flox/floxMerCreMer Stra8+/− ovaries and Smad4flox/floxMerCreMer Stra8−/− ovaries
GSE68788	IFNβ expression is restricted to a subpopulation of splenic pDCs exhibiting a specific immune modulatory transcriptome signature
GSE68868	Gene expression in IL-17RA-deficient and wild-type mice following Giardia muris infection
GSE69055	Dazl is required for TET-mediated reprogramming to a naïve pluripotent state (I)
GSE69188	B-cell response following malaria infection in WT and miR-155 KO mice
GSE69217	Time course of gene expression signatures in mPTECs during ex vivo culture
GSE69320	Development of gene expression signatures for contact-inhibited and adipogenic-differentiated 3T3-L1 and NIH3T3 fibroblasts
GSE69356	Dazl is required for TET-mediated reprogramming to a naïve pluripotent state (II)
GSE69357	Dazl is required for TET-mediated reprogramming to a naïve pluripotent state
GSE69703	Comparison of transcriptomic profile of the murine B16F1-GFP-M melanoma cells with the derived dormant B16F1-GFP-D cells
GSE70194	Glis3 plays a crucial role in spermatogenesis [848_827]
GSE70195	Glis3 plays a crucial role in spermatogenesis [923]
GSE70196	Glis3 plays a crucial role in spermatogenesis
GSE70527	CD-1mice: db/db vs db/+
GSE71125	Mammary Gland from hNAG-1 overexpressing mice
GSE71184	Role of FMRP in neurogenesis
GSE71243	Transcriptome of mouse thymic and thyroid epithelial cells
GSE71489	Bisphenol A modulation of DNA repair
GSE71926	Identification of a Highly Immunogenic Mouse Breast Cancer Sub Cell Line, 4T1-S
GSE72016	Mouse-specific skin and blood transcriptional responses after intradermal administration of flagellin
GSE72916	Gene expression signature of differentiated human and mouse muscle cells
GSE73202	Seeking genes responsible for developmental origins of health and disease (DOHaD) from the fetal mouse brain following maternal food deprivation (FD) and food restriction (FR) using OMICS approach
GSE74021	Gene expression signatures for IhhN protein induced cells
GSE74023	Gene expression and Gli1-ChIP in IhhN protein induced cells
GSE75682	Characterization of Glucocorticoid Receptor (GR) in Mouse Liver
GSE75683	GRα-independent transcriptional activity of hGRβ in GR Liver Knockout Mouse
GSE75740	Functional characterization of hGRβ Isoform in mouse liver
GSE76088	SIRT1 dosage-dependent effects on cell proliferation and metabolism
GSE76266	Transcriptional profiles of induced thyroid follicular like cells.
GSE76459	Whale (Koiwashi kujira, Minke whale) Meat Extract Supplementation in Diet of Senescence-Accelerated Prone Mouse (SAMP8) Positively Affects Learning Memory Formation and Genome-Wide Changes in the Brain
GSE77757	SIRT1 regulates methionine metabolism and pluripotency of mouse embrynoic stem cells (mESCs)
... Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here

Data table

COL

ROW

NAME

SPOT_ID

CONTROL_TYPE

REFSEQ

GB_ACC

GENE

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

TIGR_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

266

170

GE_BrightCorner

pos

266

168

DarkCorner

pos

266

166

DarkCorner

pos

266

164

DarkCorner

pos

266

162

DarkCorner

pos

266

160

DarkCorner

pos

266

158

DarkCorner

pos

266

156

DarkCorner

pos

266

154

DarkCorner

pos

266

152

DarkCorner

pos

266

150

DarkCorner

pos

266

148

NM_009912

A_52_P616356

FALSE

NM_009912

12768

Ccr1

chemokine (C-C motif) receptor 1

Mm.274927

ENSMUST00000026911

NP813468

ref|NM_009912|gb|AK076275|gb|AK031109|ens|ENSMUST00000026911

chr9:123681918-123681859

mm|9qF4

Mus musculus chemokine (C-C motif) receptor 1 (Ccr1), mRNA [NM_009912]

AGTATAAGATGTTATGTCAAAAAATTAAATCTGTAACAAACTAAAGTTTTTCTATCCAAT

266

146

NM_008725

A_52_P580582

FALSE

NM_008725

230899

Nppa

natriuretic peptide precursor type A

Mm.19961

TC1481091

ref|NM_008725|gb|AK147180|gb|BC089615|riken|I920194N08

chr4:146991457-146991516

mm|4qE2

Mus musculus natriuretic peptide precursor type A (Nppa), mRNA [NM_008725]

GO:0005179(hormone activity)|GO:0005576(extracellular region)|GO:0005737(cytoplasm)|GO:0007582(physiological process)|GO:0050880(regulation of blood vessel size)

CTTCCTGCCTTCATCTATCACGATCGATGTTAAATGTAGATGAGTGGTCTAGTGGGGTCT

266

144

NM_007473

A_52_P403405

FALSE

NM_007473

11832

Aqp7

aquaporin 7

Mm.8728

ENSMUST00000030136

NP816185

ref|NM_007473|gb|AK131744|gb|AK076642|ens|ENSMUST00000030136

chr4:41172732-41172673

mm|4qA5

Mus musculus aquaporin 7 (Aqp7), mRNA [NM_007473]

TCTGTGCCTCTAGAGCACTTCTAAGTAGAGCTTCTCTTTGACCACAACCGTACTGCAATA

266

142

AK046412

A_52_P819156

FALSE

AK046412

ENSMUST00000094955

NP577252

gb|AK046412|ens|ENSMUST00000094955|riken|B230380O10|tc|NP577252

chr4:98688985-98689044

mm|4qC6

Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230380O10 product:hypothetical protein, full insert sequence. [AK046412]

AACTAAACTTTACGGTGACCCTCTATTTTTATTATGCCACATGTATTTTAAGAGAGGTGG

266

140

NM_028752

A_51_P331831

FALSE

NM_028752

74096

Hvcn1

hydrogen voltage-gated channel 1

Mm.28804

ENSMUST00000100747

NP427055

ref|NM_028752|ref|NM_001042489|gb|AK154880|ens|ENSMUST00000100747

chr5:121476234-121476293

mm|5qF

Mus musculus hydrogen voltage-gated channel 1 (Hvcn1), transcript variant 2, mRNA [NM_028752]

GO:0005216(ion channel activity)|GO:0006810(transport)|GO:0006811(ion transport)|GO:0016021(integral to membrane)

TCAGTGCTCACAAATAAAACCTGTCAGGCTTTTCCTCTAAGTACAAGTTAAAGAATTATC

266

138

ignore

266

136

NM_008159

A_51_P430630

FALSE

NM_008159

14762

Gpr33

G protein-coupled receptor 33

Mm.12890

ENSMUST00000040161

NP048179

ref|NM_008159|gb|AF045766|gb|BC064084|ens|ENSMUST00000040161

chr12:50036303-50036244

mm|12qB3

Mus musculus G protein-coupled receptor 33 (Gpr33), mRNA [NM_008159]

GO:0001584(rhodopsin-like receptor activity)|GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004982(N-formyl peptide receptor activity)|GO:0005887(integral to plasma membrane)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor protein signaling pathway)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0045028(purinergic nucleotide receptor activity, G-protein coupled)

CTCACTAAGAGTCAGCCATTACCTTTACACTTGACACTGGGACTTGCAGTGGTGACTATT

266

134

AK084122

A_52_P502357

FALSE

AK084122

320122

C230086J09Rik

RIKEN cDNA C230086J09 gene

Mm.37126

TC1522326

gb|AK084122|gb|AK048966|riken|D130096I20|riken|C230086J09

chr14:88145282-88145223

mm|14qE2.1

Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130096I20 product:unclassifiable, full insert sequence. [AK084122]

CTCACTAGTGAAGACACCATAGAGTATGAAACTTATTGTAACTCTTTTTAAGTCAGTGTC

266

132

XM_486185

A_52_P299964

FALSE

XM_486185

270118

Maml2

mastermind like 2 (Drosophila)

Mm.116898

ENSMUST00000034401

NP515033

gb|XM_486185|gb|BC053388|ens|ENSMUST00000034401|ref|XM_972692

chr9:13457783-13457842

mm|9qA1

PREDICTED: Mus musculus mastermind like 2 (Drosophila) (Maml2), mRNA [XM_486185]

GO:0003713(transcription coactivator activity)|GO:0005634(nucleus)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)

CATGGCAATACCAAGCCTTTGTTCCATTTTAACTCAGACCAAGCAAACCAGCAGATGCCT