NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6984 Query DataSets for GPL6984
Status Public on Jun 23, 2008
Title Illumina Human1M-Duov3 DNA Analysis BeadChip (Human1M-Duov3_B)
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina, Inc.
Manufacture protocol See manufacturer's website
Catalog number WG-311-1001
 
Description over one million markers to interrogate human genetic variation using single nucleotide polymorphisms (SNPs) and copy number variation (CNV) probes
 
Web link http://www.illumina.com/pages.ilmn?ID=261
Submission date Jun 20, 2008
Last update date Jan 14, 2015
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (1135) GSM423367, GSM423368, GSM423369, GSM423370, GSM423371, GSM423372 
Series (33)
GSE16894 Illumina HapMap CEU (1M-Duo)
GSE16895 Illumina HapMap CHB and JPT (1M-Duo)
GSE16896 Illumina HapMap YRI (1M-Duo)

Data table header descriptions
ID IlmnID
Name
IlmnStrand
SNP
AddressA_ID
AlleleA_ProbeSeq
AddressB_ID
AlleleB_ProbeSeq
GenomeBuild
Chr
MapInfo
Ploidy
Species
Source
SourceVersion
SourceStrand
SEQUENCE SourceSeq
TopGenomicSeq
BeadSetId
CNV_Probe
Intensity_Only
Exp_Clusters
SNP_ID ncbi SNP accession
PROBE #PROBE = PROBE Name

Data table
ID Name IlmnStrand SNP AddressA_ID AlleleA_ProbeSeq AddressB_ID AlleleB_ProbeSeq GenomeBuild Chr MapInfo Ploidy Species Source SourceVersion SourceStrand SEQUENCE TopGenomicSeq BeadSetId CNV_Probe Intensity_Only Exp_Clusters SNP_ID PROBE
200003-0_B_R_1526882017 200003 BOT [T/C] 243622332 GCCAGCTTCGTTGTCTTCCTCGTGGCCGAGAAGTCCACCAAGGCCAAGCA 36 9 139026180 diploid Homo sapiens Unknown 0 TOP GTCCCACACGTAGTTCGCCAGCCAGTAGATGATGGGGTTGCAGCCGCTGACAAACTGCAG[A/G]TGCTTGGCCTTGGTGGACTTCTCGGCCACGAGGAAGACAACGAAGCTGGCCGGCACGAAG GTCCCACACGTAGTTCGCCAGCCAGTAGATGATGGGGTTGCAGCCGCTGACAAACTGCAG[A/G]TGCTTGGCCTTGGTGGACTTCTCGGCCACGAGGAAGACAACGAAGCTGGCCGGCACGAAG 18 0 0 3 200003
200006-0_T_R_1526882018 200006 TOP [A/G] 243622423 AGACTGTGGATGAATAATGCTGGTGAGTGTCTGGCCCTCGGGGAGGCCCA 36 9 139046223 diploid Homo sapiens Unknown 0 BOT ACATGCCCCACTCAGCGCCACCCCCGTCCTCCCCTCCCAGGTTGCCTAGCTGTCCCCAGC[T/C]TGGGCCTCCCCGAGGGCCAGACACTCACCAGCATTATTCATCCACAGTCTCCCAGGATCA TGATCCTGGGAGACTGTGGATGAATAATGCTGGTGAGTGTCTGGCCCTCGGGGAGGCCCA[A/G]GCTGGGGACAGCTAGGCAACCTGGGAGGGGAGGACGGGGGTGGCGCTGAGTGGGGCATGT 18 0 0 3 200006
200047-0_B_R_1526882019 200047 BOT [T/C] 243624420 AGCCTCATCCCCAGGACCCCCTTGGCTCAGAGTGTGGTGCTAGAAACTGG 36 2 219793146 diploid Homo sapiens Unknown 0 TOP AGCCCTCTGGGGACTTGCAGGGGTAGGTGTAAAGGTGGCAGTACTGGGGCTGGGCTGGGG[A/G]CCAGTTTCTAGCACCACACTCTGAGCCAAGGGGGTCCTGGGGATGAGGCTAGAGTCCCGT AGCCCTCTGGGGACTTGCAGGGGTAGGTGTAAAGGTGGCAGTACTGGGGCTGGGCTGGGG[A/G]CCAGTTTCTAGCACCACACTCTGAGCCAAGGGGGTCCTGGGGATGAGGCTAGAGTCCCGT 18 0 0 3 200047
200050-0_T_R_1526882020 200050 TOP [C/G] 247628381 TGTATTCCTGGGCATCAGTTATCCTTATCTGTCATTGACAAATCAGGAAC 247629382 TGTATTCCTGGGCATCAGTTATCCTTATCTGTCATTGACAAATCAGGAAG 36 2 219797929 diploid Homo sapiens Unknown 0 BOT GCCTCGACCCCTTTGCCCTATATTAGAAGTGAGATTCAGGGGTTGTGAGCTTAAGAGACA[C/G]TTCCTGATTTGTCAATGACAGATAAGGATAACTGATGCCCAGGAATACACCCACACCTCC GGAGGTGTGGGTGTATTCCTGGGCATCAGTTATCCTTATCTGTCATTGACAAATCAGGAA[C/G]TGTCTCTTAAGCTCACAACCCCTGAATCTCACTTCTAATATAGGGCAAAGGGGTCGAGGC 18 0 0 3 200050
200052-0_B_R_1526882021 200052 BOT [T/A] 248687413 TCTCTGTGGGCTGGTGGCAAGGACCCTCGGGGTAAAACTAATGGTTAGGT 248695366 TCTCTGTGGGCTGGTGGCAAGGACCCTCGGGGTAAAACTAATGGTTAGGA 36 2 219783037 diploid Homo sapiens Unknown 0 TOP GCATACACCCCACCTCGGGACAACAGAGCCTCGTGTCTGGGGTGAGGAGAAAAGTGTGAG[A/T]CCTAACCATTAGTTTTACCCCGAGGGTCCTTGCCACCAGCCCACAGAGAGGACGGGATGG GCATACACCCCACCTCGGGACAACAGAGCCTCGTGTCTGGGGTGAGGAGAAAAGTGTGAG[A/T]CCTAACCATTAGTTTTACCCCGAGGGTCCTTGCCACCAGCCCACAGAGAGGACGGGATGG 18 0 0 3 200052
200053-0_B_F_1526882022 200053 BOT [T/C] 243625345 GGTCAGCATTGACCACAGTTGAGAGCCTGAGAAGTCAAAGATCAGTCGCC 36 2 219783289 diploid Homo sapiens Unknown 0 BOT ACGAGGATCTGGTCAGCATTGACCACAGTTGAGAGCCTGAGAAGTCAAAGATCAGTCGCC[T/C]ACTACCCCACCCAAAGCGGGCCACATCACCAGCCGCCCCAGGCCTGTAGTCCTGTACCTG CAGGTACAGGACTACAGGCCTGGGGCGGCTGGTGATGTGGCCCGCTTTGGGTGGGGTAGT[A/G]GGCGACTGATCTTTGACTTCTCAGGCTCTCAACTGTGGTCAATGCTGACCAGATCCTCGT 18 0 0 3 200053
200070-0_B_F_1526882023 200070 BOT [G/C] 247629398 CAGGTTGTGTCCCAGGCTAGATATGAAAACACAAACAAGTCTCTTAACTG 247630345 CAGGTTGTGTCCCAGGCTAGATATGAAAACACAAACAAGTCTCTTAACTC 36 16 16174099 diploid Homo sapiens Unknown 0 BOT GATTTGAGTCCCAGGTTGTGTCCCAGGCTAGATATGAAAACACAAACAAGTCTCTTAACT[C/G]TTTAAGACTTCAGTTTCTTGGCTGGGCACAGTGGCTCACACCTGTAACCCCAGCACTTTG CAAAGTGCTGGGGTTACAGGTGTGAGCCACTGTGCCCAGCCAAGAAACTGAAGTCTTAAA[C/G]AGTTAAGAGACTTGTTTGTGTTTTCATATCTAGCCTGGGACACAACCTGGGACTCAAATC 18 0 0 3 200070
200078-0_T_R_1526881818 200078 TOP [C/G] 248696401 GACCAGGCAGGAAGTAGGGAGGAAGCCACAGGTCCTGGTGTGGGAGATGC 248696403 GACCAGGCAGGAAGTAGGGAGGAAGCCACAGGTCCTGGTGTGGGAGATGG 36 16 16194115 diploid Homo sapiens Nakamura_Oct07 0 BOT CAGCTCACAGACGACAAGAACAAAGCCAGACCCGTGGGCTCGCACTCAGCTCTCCCCTCC[C/G]CATCTCCCACACCAGGACCTGTGGCTTCCTCCCTACTTCCTGCCTGGTCCGTCCCTTTCC GGAAAGGGACGGACCAGGCAGGAAGTAGGGAGGAAGCCACAGGTCCTGGTGTGGGAGATG[C/G]GGAGGGGAGAGCTGAGTGCGAGCCCACGGGTCTGGCTTTGTTCTTGTCGTCTGTGAGCTG 18 0 0 3 200078
200087-0_B_F_1526882024 200087 BOT [T/G] 243625379 GCACCCTTCGTGGAGGGTGGAGGAGTTGAGATTCCAGGTTGTGAGCCCAG 36 16 16153665 diploid Homo sapiens Unknown 0 BOT GCATGGAGTAGCACCCTTCGTGGAGGGTGGAGGAGTTGAGATTCCAGGTTGTGAGCCCAG[T/G]GAGCCCCTGACCCAGGTGGGAACTGACCCCTGGGGCCCCAGCATGGCTGTCTTGCACAGT ACTGTGCAAGACAGCCATGCTGGGGCCCCAGGGGTCAGTTCCCACCTGGGTCAGGGGCTC[A/C]CTGGGCTCACAACCTGGAATCTCAACTCCTCCACCCTCCACGAAGGGTGCTACTCCATGC 18 0 0 3 200087
200091-0_T_F_1526882025 200091 TOP [A/C] 243626322 AGAGCAAAGAACTCAGGTTTTGGGTGTCGGTGTCTCAAGATGTGTGGCAA 36 16 16188655 diploid Homo sapiens Unknown 0 TOP CCCAGCAAGAAGAGCAAAGAACTCAGGTTTTGGGTGTCGGTGTCTCAAGATGTGTGGCAA[A/C]AGCTTCCTGTCTACCAAGCTCTGTGCATAGGAGGCGTGAGGACAAAGCTTTCTAGTTCAT CCCAGCAAGAAGAGCAAAGAACTCAGGTTTTGGGTGTCGGTGTCTCAAGATGTGTGGCAA[A/C]AGCTTCCTGTCTACCAAGCTCTGTGCATAGGAGGCGTGAGGACAAAGCTTTCTAGTTCAT 18 0 0 3 200091
200096-0_T_F_1526882027 200096 TOP [A/C] 243627412 TTGAGTGTGGCCTTGGGGCAAGTCATCTCCCTTAGGTGCAATTCTCTTGT 36 16 16195546 diploid Homo sapiens Unknown 0 TOP CCTGAGAGTTTTGAGTGTGGCCTTGGGGCAAGTCATCTCCCTTAGGTGCAATTCTCTTGT[A/C]TGCAAAATGGGAATAGAGTTGTTCTCATTTGGCATTTTCTCTTATTGCGTTTAATTATTT CCTGAGAGTTTTGAGTGTGGCCTTGGGGCAAGTCATCTCCCTTAGGTGCAATTCTCTTGT[A/C]TGCAAAATGGGAATAGAGTTGTTCTCATTTGGCATTTTCTCTTATTGCGTTTAATTATTT 18 0 0 3 200096
200124-0_B_R_1526882028 200124 BOT [T/C] 243628392 CTGCCCACATTTTGGAAAGTAGAAAGCAAGTAGGCAACTAAGGACACTCT 36 7 150564216 diploid Homo sapiens Unknown 0 TOP TTTCTGTGATGGCTCCTTGCAGAGCAGGGCTAGCCTGTAAGCAATGCACTGAGAGTAGCC[A/G]AGAGTGTCCTTAGTTGCCTACTTGCTTTCTACTTTCCAAAATGTGGGCAGTGAAAGAACT TTTCTGTGATGGCTCCTTGCAGAGCAGGGCTAGCCTGTAAGCAATGCACTGAGAGTAGCC[A/G]AGAGTGTCCTTAGTTGCCTACTTGCTTTCTACTTTCCAAAATGTGGGCAGTGAAAGAACT 18 0 0 3 200124
200199-0_B_R_1526882030 200199 BOT [G/C] 247632344 AGGGCTCCTGAGGTATGTCTCCATGAAAATGATCATATGGAGAAATGACG 247633330 AGGGCTCCTGAGGTATGTCTCCATGAAAATGATCATATGGAGAAATGACC 36 22 40847933 diploid Homo sapiens Unknown 0 TOP AATTCATCCAAATTTTCTGCCAAAAATAGAAATCTCTTTGCAGTACATTTAGACAGATCA[C/G]GTCATTTCTCCATATGATCATTTTCATGGAGACATACCTCAGGAGCCCTCCATCTCCCTG AATTCATCCAAATTTTCTGCCAAAAATAGAAATCTCTTTGCAGTACATTTAGACAGATCA[C/G]GTCATTTCTCCATATGATCATTTTCATGGAGACATACCTCAGGAGCCCTCCATCTCCCTG 18 0 0 3 200199
200240-0_T_F_1526882031 200240 TOP [C/G] 247633408 CTGATTTGCCACCTGGATGAAGGCAGACATCAACATGGGTCAGCACGTTC 247634413 CTGATTTGCCACCTGGATGAAGGCAGACATCAACATGGGTCAGCACGTTG 36 1 20850186 diploid Homo sapiens Unknown 0 TOP GCGTAGCATGTCTGATTTGCCACCTGGATGAAGGCAGACATCAACATGGGTCAGCACGTT[C/G]AGTTACGGGAGTGGGAAATTACATGAGGCCTGGGCCTCTGCGTTCCCAAGCTGTGCGTTC GCGTAGCATGTCTGATTTGCCACCTGGATGAAGGCAGACATCAACATGGGTCAGCACGTT[C/G]AGTTACGGGAGTGGGAAATTACATGAGGCCTGGGCCTCTGCGTTCCCAAGCTGTGCGTTC 18 0 0 3 200240
200251-0_T_R_1526882032 200251 TOP [A/C] 243629315 TTTGCATTTAATATTTCACAATTCCTGTAAGAGAGGCTAGTCAGGAGGGA 36 1 20850335 diploid Homo sapiens Unknown 0 BOT CTTAGCGAAAGTGACGGATGAGCAGTAAGTAAGTAAGTGTGGGGATTTAAACTTGAGGGT[T/G]TCCCTCCTGACTAGCCTCTCTTACAGGAATTGTGAAATATTAAATGCAAATTTACAACTG CAGTTGTAAATTTGCATTTAATATTTCACAATTCCTGTAAGAGAGGCTAGTCAGGAGGGA[A/C]ACCCTCAAGTTTAAATCCCCACACTTACTTACTTACTGCTCATCCGTCACTTTCGCTAAG 18 0 0 3 200251
200258-0_T_R_1526882033 200258 TOP [A/C] 243629338 GCCTAAGGATTAAAGAAGGGGCCAAGGCTGGATCCTTTTCATGCCCCTCC 36 1 20869344 diploid Homo sapiens Unknown 0 BOT ATTTATGACTGTGAGTACCTTTGAATGAGGGCCAGAGGGGGTTGAGGGTCTAGGTGCCAA[T/G]GGAGGGGCATGAAAAGGATCCAGCCTTGGCCCCTTCTTTAATCCTTAGGCGGGAGGAAAG CTTTCCTCCCGCCTAAGGATTAAAGAAGGGGCCAAGGCTGGATCCTTTTCATGCCCCTCC[A/C]TTGGCACCTAGACCCTCAACCCCCTCTGGCCCTCATTCAAAGGTACTCACAGTCATAAAT 18 0 0 3 200258
200260-0_B_F_1526881813 200260 BOT [G/C] 247635349 TGGCAATGTTTTCACTGTTGCTCCGACTGAGCATGAGCCTGTAGCGGTCG 247636357 TGGCAATGTTTTCACTGTTGCTCCGACTGAGCATGAGCCTGTAGCGGTCC 36 1 20865406 diploid Homo sapiens Nakamura_Oct07 0 BOT GAAGTAGTTGCTGGCAATGTTTTCACTGTTGCTCCGACTGAGCATGAGCCTGTAGCGGTC[C/G]TCCTCCTGCCGAGATGCAGATGCCCGTGGTCACGTCCCCTTGTTTGTGCCCCTGGCACAG CTGTGCCAGGGGCACAAACAAGGGGACGTGACCACGGGCATCTGCATCTCGGCAGGAGGA[C/G]GACCGCTACAGGCTCATGCTCAGTCGGAGCAACAGTGAAAACATTGCCAGCAACTACTTC 18 0 0 3 200260
200261-0_T_R_1526882034 200261 TOP [A/G] 243629380 AGTCAACCTGAGTGGCCCCTGTTCTATGCAATCAAAGGAGCCAGAGCATC 36 1 20841103 diploid Homo sapiens Unknown 0 BOT CTGGGGCCCTGACAGCCTGGGGCTGTGATCATGACTTGCCCAGGGGCCCGAGGGTGGAAA[T/C]GATGCTCTGGCTCCTTTGATTGCATAGAACAGGGGCCACTCAGGTTGACTCAAGAGCAGG CCTGCTCTTGAGTCAACCTGAGTGGCCCCTGTTCTATGCAATCAAAGGAGCCAGAGCATC[A/G]TTTCCACCCTCGGGCCCCTGGGCAAGTCATGATCACAGCCCCAGGCTGTCAGGGCCCCAG 18 0 0 3 200261
200262-0_B_F_1526882035 200262 BOT [T/C] 243630403 AAAGCCTTCAGTTAGCATACCAAGGGAAGCAGGAACAAGAGGTGAAGACA 36 1 20866804 diploid Homo sapiens Unknown 0 BOT CCATGTGGAGAAAGCCTTCAGTTAGCATACCAAGGGAAGCAGGAACAAGAGGTGAAGACA[T/C]AGGCCAGGAGCAGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGCGG CCGCCTGCCTTGGCCTCCCAAAGTGCTGGGATTACAGGCGTGAGCCACTGCTCCTGGCCT[A/G]TGTCTTCACCTCTTGTTCCTGCTTCCCTTGGTATGCTAACTGAAGGCTTTCTCCACATGG 18 0 0 3 200262
200519-0_B_R_1526882037 200519 BOT [T/C] 243633347 GTATGTGGCTCAGAGGATGAACAGAGAGGGAGAGTCTGGGCCATGTATCA 36 6 33274012 diploid Homo sapiens Unknown 0 TOP GGCCTCCCCCAGGTCACTTGCTCTGACCAAACTCCATAAGCCCTGGGAATCCCACAGGTG[A/G]TGATACATGGCCCAGACTCTCCCTCTCTGTTCATCCTCTGAGCCACATACCTGAGCTTCT GGCCTCCCCCAGGTCACTTGCTCTGACCAAACTCCATAAGCCCTGGGAATCCCACAGGTG[A/G]TGATACATGGCCCAGACTCTCCCTCTCTGTTCATCCTCTGAGCCACATACCTGAGCTTCT 18 0 0 3 200519

Total number of rows: 1199187

Table truncated, full table size 509950 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6984_Human1M-Duov3_B.csv.gz 116.3 Mb (ftp)(http) CSV

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap