NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7508 Query DataSets for GPL7508
Status Public on Dec 01, 2008
Title Blanchette/Green Splice Junction array
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Drosophila melanogaster
Manufacturer Agilent
Manufacture protocol Standard Agilent
 
Description This array is a splice junction array designed for D . Melanogaster using FlyBase 4. The array encompasses all genes that are annotated as having alternative transcripts. For each transcript, probes targeting alternative junctions and exons awere designed as well as probes targeting some constitutive (but not all) exons and junctions. The array design is very similar (essentially an update) to the design described in Blanchette et al. "Global analysis of positive and negative pre-mRNA splicing regulators in Drosophila" in Genes Dev 2005.
Probes on the array were "t-stilted", that is every probe was extended by a poly T-tail in order to move the probe off the array surface, nucleotide sequences are given with and without stilts.
 
Contributor(s) Green RE, Blanchette M
Citation(s) 15937219
Submission date Oct 22, 2008
Last update date Dec 01, 2008
Contact name Kasper Daniel Hansen
E-mail(s) khansen@compbio.berkeley.edu
Organization name UC Berkeley
Department PMB
Lab Brenner
Street address 461 Koshland Hall
City Berkeley
State/province CA
ZIP/Postal code 94720-3102
Country USA
 
Samples (28) GSM341265, GSM341266, GSM341267, GSM341268, GSM341269, GSM341270 
Series (5)
GSE13532 RNAi knockdown of NMD in D Melanogaster
GSE13940 Genome-wide analysis of alternative pre-mRNA splicing of the Drosophila hnRNP A/B family members
GSE13943 Splicing_Arrays_1

Data table header descriptions
ID
SEQUENCE Nucleotide sequence of the probe, without poly-T tail
TYPE Probe type, one of JNC (junction), EXON (exon), NEG (negative control), POS (positive control)
ORF
ORF
GENOME_ACC
FLYBASE_4_CG_NAME FlyBase 4 CG gene identifier for the probe target, ";" separated in case of multiple targets
SUBTYPE FLYBASE_4_TRANSCRIPT FlyBase 4 GC transcript identifier for the probe target, ";" separated in case of multiple targets
TM Melting temperature of the probe
ROW Row position of the probe on the array
COL Column position of the probe on the array
SEQUENCE_WITH_STILTS Nucleotide sequence of the probe, with poly-T tail
CLASS Class of the probe, one of "dUPF1" (these probes targets UPF1), "dUPF2" (these probes targets UPF2), "NegativeControls", "PositiveControls" or "normal" (most probes)
SPOT_ID

Data table
ID SEQUENCE TYPE ORF ORF GENOME_ACC FLYBASE_4_CG_NAME SUBTYPE FLYBASE_4_TRANSCRIPT TM ROW COL SEQUENCE_WITH_STILTS CLASS SPOT_ID
00001 GACTACGGACAAGTACAGGTCGATGGTTAAAAAGTG JNC CG2168 CG2168 CONST CG2168-RA;CG2168-RB;CG2168-RD 150 214 GACTACGGACAAGTACAGGTCGATGGTTAAAAAGTGTTTTTTTTTTTTTTTTTTTT normal
00002 TTCAAACCCGTCAAATCGGGTCGCGTTTTCGAAGTG JNC CG2168 CG2168 ALT CG2168-RB 29 73 TTCAAACCCGTCAAATCGGGTCGCGTTTTCGAAGTGTTTTTTTTTTTTTTTTTTTT normal
00003 GTTTTCTCGCAAGGACTGGGTCAAAGAATAGCATCG JNC CG2168 CG2168 ALT CG2168-RD 58 42 GTTTTCTCGCAAGGACTGGGTCAAAGAATAGCATCGTTTTTTTTTTTTTTTTTTTT normal
00004 TCGATCAACGCAGACGTGTATAAATTAATTATGCGC JNC CG17964 CG17964 ALT CG17964-RE;CG17964-RG 54 236 TCGATCAACGCAGACGTGTATAAATTAATTATGCGCTTTTTTTTTTTTTTTTTTTT normal
00005 TCGATCAACGCAGACGTGATATGCCCTTATAGAGTA JNC CG17964 CG17964 ALT CG17964-RF 192 220 TCGATCAACGCAGACGTGATATGCCCTTATAGAGTATTTTTTTTTTTTTTTTTTTT normal
00006 ACATATATAACTTCCTGTATATGCCCTTATAGAGTA JNC CG17964 CG17964 ALT CG17964-RG;CG17964-RE 94 394 ACATATATAACTTCCTGTATATGCCCTTATAGAGTATTTTTTTTTTTTTTTTTTTT normal
00007 AAAAGTATACGTATGTATGTAAATACGACCTAACCG JNC CG17964 CG17964 ALT CG17964-RB 16 290 AAAAGTATACGTATGTATGTAAATACGACCTAACCGTTTTTTTTTTTTTTTTTTTT normal
00008 TTAGTATTTTTCTCACATATATGCCCTTATAGAGTA JNC CG17964 CG17964 ALT CG17964-RA 185 411 TTAGTATTTTTCTCACATATATGCCCTTATAGAGTATTTTTTTTTTTTTTTTTTTT normal
00009 TTTAATCAAATCATCACTATATGCCCTTATAGAGTA JNC CG17964 CG17964 ALT CG17964-RC 37 287 TTTAATCAAATCATCACTATATGCCCTTATAGAGTATTTTTTTTTTTTTTTTTTTT normal
00010 CTCCGACGGCCCAGTCAGATATGCCCTTATAGAGTA JNC CG17964 CG17964 ALT CG17964-RD 77 265 CTCCGACGGCCCAGTCAGATATGCCCTTATAGAGTATTTTTTTTTTTTTTTTTTTT normal
00011 GATTTAACTGAAAGTGAGGAAAAGGGTCACAAAATT JNC CG17964 CG17964 CONST CG17964-RG;CG17964-RB;CG17964-RE;CG17964-RF;CG17964-RC;CG17964-RA;CG17964-RD 152 76 GATTTAACTGAAAGTGAGGAAAAGGGTCACAAAATTTTTTTTTTTTTTTTTTTTTT normal
00012 ACCACAGCCCTGTTTTTAATAAGCTGGACACCCACG JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 99 323 ACCACAGCCCTGTTTTTAATAAGCTGGACACCCACGTTTTTTTTTTTTTTTTTTTT normal
00013 GGCTTACCGGTAACTATGGCCAACAAAATTGGACTG JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 55 189 GGCTTACCGGTAACTATGGCCAACAAAATTGGACTGTTTTTTTTTTTTTTTTTTTT normal
00014 AACTGGATCCTAAGATGGGCTTAACTCGACCAGCGC JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 163 413 AACTGGATCCTAAGATGGGCTTAACTCGACCAGCGCTTTTTTTTTTTTTTTTTTTT normal
00015 GTCTCAAGTGGCATCATGGCACACTCCTTCTGTTTA JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 57 419 GTCTCAAGTGGCATCATGGCACACTCCTTCTGTTTATTTTTTTTTTTTTTTTTTTT normal
00016 AAATACTACACTTGCAAGTGATTTTCCATTCCGTTT JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 110 212 AAATACTACACTTGCAAGTGATTTTCCATTCCGTTTTTTTTTTTTTTTTTTTTTTT normal
00017 GAATAATAGATATCCAAGGAACCTGGAAGCAAAGCA JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 66 400 GAATAATAGATATCCAAGGAACCTGGAAGCAAAGCATTTTTTTTTTTTTTTTTTTT normal
00018 CAGATTTTAGGAAGACGGTGGCACGAACTTTCCCGC JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 173 239 CAGATTTTAGGAAGACGGTGGCACGAACTTTCCCGCTTTTTTTTTTTTTTTTTTTT normal
00019 CGACAACGGATTCGGGAGGCAATAATATGAAAAAAT JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 127 139 CGACAACGGATTCGGGAGGCAATAATATGAAAAAATTTTTTTTTTTTTTTTTTTTT normal
00020 GTGGTGCAAACCGTGCAGGCGCAAAAAGAAATGTAT JNC CG17964 CG17964 CONST CG17964-RE;CG17964-RG;CG17964-RF;CG17964-RB;CG17964-RC;CG17964-RA;CG17964-RD 139 101 GTGGTGCAAACCGTGCAGGCGCAAAAAGAAATGTATTTTTTTTTTTTTTTTTTTTT normal

Total number of rows: 42034

Table truncated, full table size 6840 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap