NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8244 Query DataSets for GPL8244
Status Public on Mar 04, 2009
Title FL003 - INDAC Drosophila melanogaster 14.5K long oligo array
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Drosophila melanogaster
Manufacturer FlyChip Cambridge
Manufacture protocol FL003 microarrays were printed using the Genetix Qarray2 contact-printing instrument and 48 Genetix aQu75 split-pins on FMB PowerMatrix slides. Probe DNA was dissolved in 150 mM NaPO4. Full details on Flychip website (http://www.flychip.org.uk/).
Support glass
Coating other
 
Description Array mapping available at the FlyChip_long_oligonucleotide_003 (FL003) - INDAC page at the Flychip website.
 
Web link http://www.flychip.org.uk/
Contributor(s) Russell S, Meadows LA, Auburn RP, Fischer B, Micklem G, Russell RR, Rana D, Matila SS, Sykacek P, Kreil DP
Submission date Mar 03, 2009
Last update date Jul 10, 2013
Contact name Bettina Fischer
E-mail(s) bef22@cam.ac.uk
Organization name Unversity of Cambridge
Department Systems Biology Centre
Lab FlyChip
Street address Tennis Court Road
City Cambridge
ZIP/Postal code CB2 1QR
Country United Kingdom
 
Samples (26) GSM417306, GSM417307, GSM417308, GSM417309, GSM417310, GSM417311 
Series (3)
GSE15565 Expression differences between inversions and their progenitors in Drosophila melanogaster
GSE21607 Expression differences between inversions and their progenitors in Drosophila melanogaster embryos
GSE31190 Song stimulation: Conspecific song vs Control and Heterospecific song
Relations
Affiliated with GPL14121

Data table header descriptions
ID
SEQUENCE Oligonucleotide sequence
TranscriptID Transcript identifier (FlyBase)
oID Oligonucleotide identifier
FlyBase FlyBase symbol
CLONE_ID FlyBase ID
SPOT_ID Spot identifier

Data table
ID SEQUENCE TranscriptID oID FlyBase CLONE_ID SPOT_ID
ID100003001200000000 ACCGGTTGCTTTGGTGGTTACTACTTGCCAACATTGGTTCAGTTCGAGCCTGGTCTCACTTCTCCTCCT Z49777 1-Z49777_1 ARABIDOPSIS SPIKE CONTROL --ARABIDOPSIS SPIKE CONTROL
ID100004323000000001 GGTTTTGGGAGCCGAACTTGCTCAGAACACGTGGTAGCGATAGGTAGCTCATGATCGAACCCAGCC CG31112-RA 2-CG31112-RA_2 CG31112 FBgn0051112
ID100004315800000002 TCCGAAGGTGAACGATACGGATGTGTGTGGTTCGCCCTTAGTGAACAACGTCTTCAATCCCACGGG CG17446-RA 2-CG17446-RA_1 CG17446 FBgn0030121
ID100004279800000003 CCCACGAAACGCCAAGCTAAACCCGTACATTCCAGTTCCAGCGAATGCGAAGATTTCAAGCCAGACGAA CG13493-RA 3-CG13493-RA_1 comr FBgn0034667
ID100003202800000004 GCCATGAGGTCACTTTATCGAGTCCACGTGCGTTTGCATACAAGAGAGCGACAGTACAAGTGCGCCGAA CG5245-RA 3-CG5245-RA_2 CG5245 FBgn0038047
ID100004436400000005 TGTATCTCCACACCTATTGATGGGATCAGATTTGGCACGAATATTCACGAAATACAACTCTGGTTCAAA CG4250-RA 23-CG4250-RA_3 CG4250 FBgn0034761
ID100003063600000006 CACGCACAAGCCTTCGTCCTTGATCCCGCACATACCGAGTTCATTACGGAGGTTAGATATCTCATTGGT Q9LZJ2 14-Q9LZJ2_2 ARABIDOPSIS SPIKE CONTROL --ARABIDOPSIS SPIKE CONTROL
ID100004321200000007 GGAGCACATAGATGGACCGTATCCAACGATGGTCAAGCAGAACAGTGGCAAGGAGGTTCCCGTTGT CG30104-RA 3-CG30104-RA_3 CG30104 FBgn0050104
ID100003087000000008 CGACTGATGCATTTCTCAATCACAGCCATTTCTAAATCAATCGTCAAATCTAAACTAACTGCAAATTTT CG32207-RA 23-CG32207-RA_1 CG32207 FBgn0052207
ID100003363000000009 CGGCTTAGCTCTACCAGGAGTGAGCATGACCAGTTCACCCGTCTACGAGGTTATCTACTTGGCCCAACT CG1854-RA 2-CG1854-RA_2 Or43a FBgn0026389
ID100004278000000010 ATGAGCTGTGTGCCGATCAGGGTTGGGGTCATGATGAACAGGATGATAAGGACGATATTGTCTGGGGCG CG1344-RA 1-CG1344-RA_1 CG1344 FBgn0027507
ID100003039600000011 GCGGGAAGCTAGTGAGTTTCTGAGAGAGTTACCGGAGATGAAACTCGGTAATGTTCTTCAGGAGATCGG Q9LJQ4 22-Q9LJQ4_1 ARABIDOPSIS SPIKE CONTROL --ARABIDOPSIS SPIKE CONTROL
ID100003439800000012 CGACTTCAACGAGGAGGAATTATGCAGCATCACCAAGGATTCGCAGGACATTGCCGTGCTTCTGGC CG11928-RA 1-CG11928-RA_1 CG34351 FBgn0085380
ID100003210000000013 GCGGTGTGTGCTTTTATGGCCTGTGACTCAGGTGTGGATTTGGGTCAATGTGATGCTCAACACGATGCT CG5400-RA 3-CG5400-RA_3 Eh FBgn0000564
ID100004047600000014 TCCGCTGGCCCGAGACTATTGCATGCTACTTATGGCCAAGAAGTTTGTCAGTCAAACGGAGACTGCCAT CG14749-RA 3-CG14749-RA_4 CG14749 FBgn0033316
ID100003128400000015 AGGGCTTCACCATTCAGCATTGGTCCAAGACGGTTATATTGATCACCTTGATGTGCGTAACCGGTGCCA CG2991-RA 2-CG2991-RA_2 CG2991 FBgn0031474
ID100003740400000016 TTTCGGCATCTCGAAACTGCTCTACTCCCACATTACCAGTGTCGAATCTTCGATGAGGGGCAAAG CG10659-RA 23-CG10659-RA_1 CG10659 FBgn0032839
ID100003625200000017 GCTGTGGCTGGAACACTTTCTAACTGGCTACTTTCAGCTATGCGGACTGGTCTGTGGCTGGAGTG CG32693-RA 2-CG32693-RA_1 Gr9a FBgn0052693
ID100004433400000018 GCGGTCTCTGCGGAGATGACTATGAAGGATCTAATTGCGTTGATTGTCCTGGACACTGGAATGGACGAA CG4201-RA 14-CG4201-RA_1 ird5 FBgn0024222
ID100003624600000019 CTCTAATGCCTCCCGCTCTATCGGCCATATCGACTTCGCTGTGTCCCAGGAAATTGACGGGTCAG CG32668-RA 26-CG32668-RA_2 CG32668 FBgn0052668

Total number of rows: 18240

Table truncated, full table size 2413 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap