NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8377 Query DataSets for GPL8377
Status Public on Mar 11, 2010
Title CCDTM miRNA700-V3 (H. sapiens and EBV subset; condensed)
Technology type spotted oligonucleotide
Distribution non-commercial
Organisms Homo sapiens; human gammaherpesvirus 4
Manufacturer NIH Clinical Center, Dept. of Transfusion Medicine, Immunogenetics Section (NIH/CC/DTM)
Manufacture protocol Oligos sythesized by Operon with 3' amine modification and purified by desalting. Oligos are adjusted to the same concentration and resuspend in 2mM phosphate buffer at 25mM oligo concentration and spotted on CodeLink(TM) Activated Slides (GE Healthcare) using an Omnigrid robotic arrayer (Genomic Solutions).
Support glass
Coating polyacrymide hydrogel polymer
 
Description Derived from GPL6773 04/01/09 - H. sapiens and EBV subset.
This is a condensed representation of the full array in Platform GPL6773.
 
Submission date Apr 01, 2009
Last update date May 25, 2012
Contact name Francesco Maria Marincola
E-mail(s) fmarincola@sidra.org
Phone 301-793-8210
Organization name Sidra Medical and Research Center
Street address Al Nasr Tower, AL Corniche Street, PO Box 26999
City Doha
ZIP/Postal code PO Box 26999
Country Qatar
 
Samples (290) GSM379385, GSM379386, GSM379387, GSM379388, GSM379389, GSM379390 
Series (1)
GSE15201 MicroRNA expression differentiates histology and predicts survival of lung cancer
Relations
Affiliated with GPL6773

Data table header descriptions
ID NIH mAdb well id plus replicate number
MADB_WELL_ID NIH mAdb plate-well identifier for oligo sample
OLIGO_ID Oligo identifier
miRBase_ACC miRBase ID
GENE_ID NCBI Gene ID
DESCRIPTON
MATURE_SANGER_REGISTRY_NAME Registry name in Sanger's mirBASE, http://microrna.sanger.ac.uk
SEQUENCE Sequence of the miRNA Target
miRNA_ID mirBASE identifiers

Data table
ID MADB_WELL_ID OLIGO_ID miRBase_ACC GENE_ID DESCRIPTON MATURE_SANGER_REGISTRY_NAME SEQUENCE miRNA_ID
6519883_1 6519883 MIMAT0000241:1a2 MI0000251 406990 hsa-mir-208a hsa-miR-208a AUAAGACGAGCAAAAAGCUUGU hsa-miR-208a
6519885_1 6519885 MIMAT0000075:1a4 MI0000076 406982 hsa-mir-20a hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG hsa-miR-20a
6519887_1 6519887 MIMAT0000076:1a6 MI0000077 406991 hsa-mir-21 hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA hsa-miR-21
6519888_1 6519888 MIMAT0000062:1a7 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU hsa-let-7a
6519889_1 6519889 MIMAT0000267:1a8 MI0000286 406992 hsa-mir-210 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA hsa-miR-210
6519890_1 6519890 MIMAT0000063:1a9 MI0000063 406884 hsa-let-7b hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU hsa-let-7b
6519892_1 6519892 MIMAT0000064:1a11 MI0000064 406885 hsa-let-7c hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU hsa-let-7c
6519893_1 6519893 MIMAT0000269:1a12 MI0000288 406994 hsa-mir-212 hsa-miR-212 UAACAGUCUCCAGUCACGGCC hsa-miR-212
6519894_1 6519894 MIMAT0000065:1a13 MI0000065 406886 hsa-let-7d hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU hsa-let-7d
6519896_1 6519896 MIMAT0000066:1a15 MI0000066 406887 hsa-let-7e hsa-let-7e UGAGGUAGGAGGUUGUAUAGU missing U hsa-let-7e
6519897_1 6519897 MIMAT0000271:1a16 MI0000290 406996 hsa-mir-214 hsa-miR-214 ACAGCAGGCACAGACAGGCAG hsa-miR-214
6519898_1 6519898 MIMAT0000067:1a17 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU hsa-let-7f
6519899_1 6519899 MIMAT0000272:1a18 MI0000291 406997 hsa-mir-215 hsa-miR-215 AUGACCUAUGAAUUGACAGAC hsa-miR-215
6519900_1 6519900 MIMAT0000414:1a19 MI0000433 406890 hsa-let-7g hsa-let-7g UGAGGUAGUAGUUUGUACAGU missing U hsa-let-7g
6519901_1 6519901 MIMAT0000273:1a20 MI0000292 406998 hsa-mir-216a hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA hsa-miR-216a
6519902_1 6519902 MIMAT0000415:1a21 MI0000434 406891 hsa-let-7i hsa-let-7i UGAGGUAGUAGUUUGUGCUGU missing U hsa-let-7i
6519906_1 6519906 MIMAT0002814:1b1 MI0003133 574451 hsa-mir-432 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG hsa-miR-432
6519912_1 6519912 MIMAT0001541:1b7 MI0001648 554213 hsa-mir-449a hsa-miR-449 UGGCAGUGUAUUGUUAGCUGGU hsa-miR-449
6519916_1 6519916 MIMAT0001635:1b11 MI0001733 574412 hsa-mir-452 hsa-miR-452 UGUUUGCAGAGGAAACUGAGAC hsa-miR-452
6519922_1 6519922 MIMAT0002175:1b17 MI0002469 574436 hsa-mir-485 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC hsa-miR-485-5p

Total number of rows: 198

Table truncated, full table size 21 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap