NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8562 Query DataSets for GPL8562
Status Public on May 18, 2010
Title SMD Print_580 Mycobacterium tuberculosis
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Mycobacterium tuberculosis
Manufacturer Stanford Functional Genomics Facility, Stanford School of Medicine
Manufacture protocol Material is transferred from microtiter plate wells to the slide surface by an automated print head
Support glass
 
 
Submission date May 18, 2009
Last update date May 18, 2010
Contact name Martin I Voskuil
E-mail(s) martin.voskuil@ucdenver.edu
Phone 303-724-4219
Organization name University of Colorado Denver
Department Microbiology
Lab Voskuil Lab
Street address 12800 E. 19th Ave
City Aurora
State/province CO
ZIP/Postal code 80045
Country USA
 
Samples (23) GSM404399, GSM404401, GSM404405, GSM404414, GSM404416, GSM404420 
Series (1)
GSE16146 The response of Mycobacterium tuberculosis to reactive oxygen and nitrogen species

Data table header descriptions
ID
MetaColumn
MetaRow
Column
Row
Reporter Name
ORF ORF name
Reporter Species
Reporter BioSequence [length]
SEQUENCE
Repoter Biosequence Type
Repoter BioSequence PolymerType
Reporter Group[role]
Reporter ControlType
SPOT_ID

Data table
ID MetaColumn MetaRow Column Row Reporter Name ORF Reporter Species Reporter BioSequence [length] SEQUENCE Repoter Biosequence Type Repoter BioSequence PolymerType Reporter Group[role] Reporter ControlType SPOT_ID
1 1 1 1 1 RV0001-pcr RV0001 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
154 1 1 1 10 RV2335-pcr RV2335 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
244 1 1 6 15 RV3847-pcr RV3847 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3748 1 4 8 17 EMPTY Not Applicable unknown_sequence unknown_polymer Control control_negative CONTROL
3477 1 4 9 1 RV0329C-pcr RV0329C Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3494 1 4 9 2 RV0687-pcr RV0687 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3511 1 4 9 3 RV0757-pcr RV0757 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3528 1 4 9 4 RV1103C-pcr RV1103C Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3545 1 4 9 5 RV1461-pcr RV1461 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3562 1 4 9 6 RV1531-pcr RV1531 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3579 1 4 9 7 RV1889C-pcr RV1889C Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3596 1 4 9 8 RV2247-pcr RV2247 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3613 1 4 9 9 RV2605C-pcr RV2605C Mycobacterium tuberculosis PCR_amplicon DNA Experimental
261 1 1 6 16 RV3917C-pcr RV3917C Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3630 1 4 9 10 RV2663-pcr RV2663 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3647 1 4 9 11 RV3021C-pcr RV3021C Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3664 1 4 9 12 RV3379C-pcr RV3379C Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3681 1 4 9 13 RV3449-pcr RV3449 Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3698 1 4 9 14 RV3807C-pcr RV3807C Mycobacterium tuberculosis PCR_amplicon DNA Experimental
3715 1 4 9 15 ORFD0012-oligo Mycobacterium tuberculosis TGGCCACGAACATGTGTCCGCGACTGGCGTCTGCGATACCAACCCAATCGGTTACTATAGAAACTGTTCC ss_oligo DNA Experimental ORFD0012-oligo

Total number of rows: 4608

Table truncated, full table size 454 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL8562_Print_580.adf.gz 90.1 Kb (ftp)(http) ADF

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap