NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8584 Query DataSets for GPL8584
Status Public on Jul 24, 2009
Title Prunus persica 5.7K microPEACH1.0
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Prunus persica
Manufacturer Home made MicroCRIBI spotting service, using Operon oligo probes
Manufacture protocol 1.Oligos are arrayed in Genetix 384 Well Microarray Plates (Cat# X7020). Each well contains 600 pmol of 70-mer oligo.
2. Resuspend oligos in 17 ┬ÁL of Telechem Microspotting solution 1X.
3. Seal plates with Corning seals and after oligos resuspenction print probe with the MicroGrid II Biorobotics spotter.
4. Print is performed with 48 Stealth pins.
5. After printing run plates are stored at -20 C degree.
6. Every 4 months plates are lyophilized and resuspended in adjusted water volume according to the number of spotting runs. This, to maintain the same volume and concentration in all plate well.
Support glass
Coating aminosilane
 
Description This set consists of 4,806 70mer oligonucleotides (Operon version 1.0) designed on Prunus persica (peach) Unigene clusters, mainly in the 3 end terminal region. Each oligonucleotide is spotted by our robotic station Biorobotics Microgrid II, in one replicate on a MICROMAX glass slide SuperChip I (Cat No MPS696) provided by PerkinElmer Life Sciences Inc. The deposition is qualitatively assessed by a scan of the spotted slide at 10 micron resolution, using a GSI Lumonics scanner and a protocol that allows the detection of spotted features through the salts derived from the dried solution in which oligonucleotides are dissolved. Moreover all spotted batch are evaluated for the spot shape and oligo linking onto the slide surface using the vistra green method. Microarray slides that meet the quality standards, are washed as recommended by the supplier and the glass slides are stored, ready for use, in the dark under deep vacuum.
 
Web link http://microcribi.cribi.unipd.it/
Contributor(s) Trainotti L, Tadiello A, Cagnin S, Pacchioni B, Millino C
Submission date May 22, 2009
Last update date Jul 24, 2009
Contact name Livio Trainotti
E-mail(s) livio.trainotti@unipd.it
Phone +390498276292
Organization name University of Padova
Department Biology
Lab Applied botany
Street address Via Ugo Bassi 58/B
City Padova
ZIP/Postal code 35131
Country Italy
 
Samples (16) GSM407348, GSM407357, GSM407358, GSM407359, GSM456509, GSM456513 
Series (4)
GSE16224 Effect of 1-methylcyclopropene (1-MCP) on preclimacteric nectarine (Prunus persica cv Stark Red Gold) fruit.
GSE18280 Transcriptomic analysis reveals cold responsive genes implicated in peach low temperature tolerance
GSE19828 A transcriptomic approach to elucidate apricot fruit development using an oligonucleotide peach microarray

Data table header descriptions
ID
R array row (slide row)
C array column (slide column)
MR array meta row (block row)
MC array meta column (block column)
SR array subrow
SC array subcolumn
Accnos
Operon_ID probe unique identification code as provided by Operon
Contig_name in lab sequence unique identifiaction number
Annotation putative annotation based on BLAST seaches
CRIBI_ID unique identification code as provided by the CRBI spotting facility
SEQUENCE
GB_ACC GenBank accession number
SPOT_ID

Data table
ID R C MR MC SR SC Accnos Operon_ID Contig_name Annotation CRIBI_ID SEQUENCE GB_ACC SPOT_ID
1 1 1 1 1 1 1 emb|AM290117.1| PE00000098 143 cellulose synthase-like protein D4 [Populus tremuloides] 001A08 GGTTTTAGCTCATCTCTATCCTTTTGCCAAAGGGTTGATGGGGAGACGAGGGAGGACACCCACCATTGTT AM290117.1
2 1 2 1 1 1 2 gb|FC867797.1| PE00000122 170 transport inhibitor response 1 (TIR1), putative [Arabidopsis thaliana] 001E08 CCAAATTTTATACGTTTCAGGTTGTGCATCCTTGACCCCACTAGACCTGACGCTGTCACCATGCAGCCAC FC867797.1
3 1 3 1 1 1 3 gb|AF498243.1| PE00000146 194 unnamed protein product [Solanum tuberosum 001I08 GTGCTTGGTCATGCTGCACTAGGTTATGAGCAATATTAGTTGGTGCTTTGTTGCCACAGTAGAACCTCAT AF498243.1
4 1 4 1 1 1 4 gb|FC863181.1| PE00000170 220 hypothetical protein, 22K - common tobacco 001M08 AGTTGAAATATATGAAGGTTCCTCTGCTGAGATTAAGACTTTGGTTAAGGAGCGCAAGGAGGCAGGGTTG FC863181.1
5 1 5 1 1 1 5 gb|BU041664.1| PE00000102 147 En/Spm-related transposon protein [Arabidopsis thaliana] 001A16 GAGGAAACTCCTCCCCTGCAAGCCACCACGGTAGGTGACCACTCATAGTACCATCGACCCCGGCTTATTG BU041664.1
6 1 6 1 1 1 6 gb|BU043908.1| PE00000126 174 Kelch repeat containing F-box protein family [Arabidopsis thaliana] 001E16 ACTCTCGTCTCAAATTTATGGTCAACTATAGCGGCCCGAACTGGTTTGAAGAGTCACATTGTACACTGTC BU043908.1
7 1 7 1 1 1 7 gb|BU047308.1| PE00000150 198 unknown protein [Arabidopsis thaliana 001I16 GGAAAAATGGGGGGCCGAAAGGGCTTCTGCTCTGGGCGATCTCATTGATAAGCTGAACAAGGCCCGAAAT BU047308.1
8 1 8 1 1 1 8 emb|AM287471.1| PE00000174 224 Putative ribosomal protein S15.[Oryza sativa] 001M16 TGAGTTCTCTATAAGTTACAAGCCTGTGAAGCACGGAAGGCCTGGTATTGGTGCTACTCACTCTTCTAGG AM287471.1
9 1 9 1 1 1 9 gb|BU040562.1| PE00000106 152 shaggy-related protein kinase 1 [Physcomitrella patens] 001A24 TCCACCCATTTTTTGATCAACTCCGTGATCCTAATGCTCGTCTCCCTAATGGGCGCCCTTTGCCTCCTCT BU040562.1
10 1 10 1 1 1 10 gb|BU044418.1| PE00000130 178 unknown protein [Arabidopsis thaliana] 001E24 ACCCCCTCGGCTGGTACACAGACTTGACAGAGATAGTAGTGGTATCCTGGTGATGGGAAGGACACAAACA BU044418.1
11 1 11 1 1 1 11 gb|DY643536.1| PE00000154 202 proline-rich protein family [Arabidopsis thaliana 001I24 TACGGCTACAACTATCGTGAATTCTTCAACTACAACAATTACTGGACAGCCTTACCAGCCTTCTTCGACA DY643536.1
12 1 12 1 1 1 12 gb|FC864493.1| PE00000178 229 unknown protein [Arabidopsis thaliana 001M24 AAGCTCACCGGCATCCAGAAACTTCAGTTAAGACGGCTGCTTCTCAAAGTGCTTTTTGGAGCTGTTTATC FC864493.1
13 1 13 1 1 1 13 gb|DW358229.1| PE00000478 673 Putative proteasome regulatory non-ATPase subunit.[Oryza sativa] 002A08 AGCTCTGCTTCAAAGCAGGTGCTTGGAAGACCCTCAATGACCAGATTGTTGTCTTATCAAAACGCCGTGG DW358229.1
14 1 14 1 1 1 14 emb|AM290993.1| PE00000502 704 unknown protein [Arabidopsis thaliana] 002E08 TGACCGCTTGCTGGCAGACAACCAAAACCTCCGGAGCCAGTTAACATCGATTGAGCAAAGCACATCACAC AM290993.1
15 1 15 1 1 1 15 gb|DY649079.1| PE00000526 731 unknown protein [Arabidopsis thaliana] 002I08 GGCAAAGTGCAGGCTGTGGATGTTGAGGCCCAGTGGAAGTTTTGCTTTCTGCCCATGTGCTTCAAGATCA DY649079.1
16 1 16 1 1 1 16 gb|BU042076.1| PE00000550 758 Hypothetical membrane protein [Corynebacterium glutamicum 002M08 ACAAGGCACCCTTTTGCCCCATGTTAAGCCGCCCGGGATTATAACGCCGCTCCCCATAATGTCACACCAT BU042076.1
17 1 17 1 1 1 17 gb|BU039300.1| PE00000482 678 unknown protein [Arabidopsis thaliana] 002A16 CTTTTTGTCTTTCCTGCCCGATGCGCCACGCTTGGGAATCTCCGCGCTTGGTTGCTTGGGCCTCTCTCGC BU039300.1
18 1 18 1 1 1 18 gb|BU040532.1| PE00000506 710 unknown protein [Arabidopsis thaliana] 002E16 CTGTCATTTGGGTCCAAAACCGACAAACTCGTCATCCCACCCTTCCCAGTCAACGACAAACTCGCCAATG BU040532.1
19 1 19 1 2 1 1 emb|AJ533700.1| PE00000193 245 maturase [Andersonia sprengelioides 001B08 TTCTGTTTCTGAAAGGAGTGAAAGTGGTGTTTCTAGTATTAACAGTGGAAGCATGAAAAGCAGTGGCAGC AJ533700.1
20 1 20 1 2 1 2 gb|FE969360.1| PE00000217 274 Hypothetical 18.5 kDa protein.[Prunus armeniaca] 001F08 GTTATGTCCAACCGGGGAAGGCATGGACATCTCAGCACTTTGAAGAACTCTGTATTTGTTGTGATTGGGA FE969360.1

Total number of rows: 5760

Table truncated, full table size 1003 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap