NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL9166 Query DataSets for GPL9166
Status Public on Feb 21, 2010
Title CapitalBio Silkworm microRNA _microarray Release 1
Technology type spotted oligonucleotide
Distribution custom-commercial
Organism Bombyx mori
Manufacturer CapitalBio, Beijing, China
Manufacture protocol 1.Specification of microarray test over silkworm microRNA. Antisense probes of 40 nt corresponding to 106 miRNAs were synthesized and were then printed with the Biochip Microarrayer, SmartArrayTM (CapitalBio Corp., Beijing, China ), on the chemically modified slides of 75×25 mm. Probes of U6 and 5srRNA were also printed on the slides as the internal controls; probes of 8 artificial sequences with 30 nt each were printed on the slides as the exogenous control (Zip5,Zip13,Zip15,Zip21,Zip23,Zip25,Y2,and Y3). Hex was used as the immobilized positive control, 50% DMSO was used for hybridizing negative control. Each block has 20 rows and 18 columns, with space 2,255 µm between any two dots. The diameter of each printed dot is 130µm. Every probe has three duplicates on each block.a
2.Quality control of microarray test on silkworm miRNAs a
The quality control is mainly based on series of negative and positive controls.a
2.1 Three types of positive controlsa
(1) Positive control for immobilizationa
The artificial sequence, 5'-GTCACATGCGATGGATCGAGCTCCTTTATCATC-3', will emit very strong fluorescent signal under excitation wavelength of cy3. A scanning signal over 8,000 of this sequence means the successful immobilization of probes on the array blocks. The name of this positive control is Hex, which is presented as follows.a
Namea
HEXa
(2) Positive controls for hybridizationa
We used small RNAs, U6 and 5srRNA of the silkworm itself as internal positive controls. The probes of U6 and 5srRNA are 5?-ATTTGCGTGTCATCCTTGCG-3? and 5?-GTACTGACCACGCCCGATGTTGCTTGACTT-3?, respectively; generally, they will produce high hybridization signals over 5,000. a
(3) Microarray-systematic positive controlsa
To avoid the interference from biomaterial RNAs, the probes unrelated to samples were also printed on the blocks to ensure microarray-systematic validity. These probes are called exogenous controls, which comprise 8 artificial sequences presented in the table below. These 8 sequences are actually not homologous to or unrelated to the silkworm genome. We synthesized the corresponding RNAs with 20?30nt to the 8 probes using Ambion?s miRNA Probe Construction kit (Cat#. 1550)?and incorporated these synthesized RNAs into the sample RNAs for microarray hybridization. In general, these exogenous controls will emit signals higher than 5,000, whereas diverse signals might be detected depending on the actual amount dosed in the sample RNAs.a
ID sequence(5'-3')a
Zip23 CAGCATCGGACCGGTAATCGGACCa
Zip5 GACCACCTTGCGATCGGGTACAGCa
Zip15 GACCGGTATGCGACCTGGTATGCGa
Zip13 CAGCGGTAGACCACCTATCGTGCGa
Zip21 TGCGATCGCAGCGGTAACCTGACCa
Zip25 GACCATAGTGCGGGTAGGTAGACCa
Y2 AGGTACGAAACGCTAAGAATa
Y3 CATTCCTAAACGGGCTGATa
a
2.2 Negative controlsa
We used two types of negative controls. One is the blank control printed with the gap-like liquid, the other is Y2 in the table above. Y2 is the best negative control due to no corresponding RNAs dosed in the sample RNAs. The hybridization signals from negative controls are so low that they cannot be filtered out to be valid signals for the subsequent analysis.a
a
The oligo name of a probe was denoted 'SW' followed by a serial number on the microarray. 106 probes for 92 unique miRNAs were used to establish the existence and profiling of miRNAs in the silkworm. These comprised 45 probes for the homology-found miRNAs, 2 for special silkworm miRNAs, 4 for the antisense strands of miRNAs, 42 for miRNAs of other organisms, and 13 as replicate probes (with unique ID) for several miRNAs.
 
 
Submission date Sep 09, 2009
Last update date Feb 21, 2010
Contact name Qingyou Xia
E-mail(s) xiaqy@swu.edu.cn
Phone 086-023-68250099
Fax 086-02368251128
Organization name Southwest University
Department College of Biotechnology
Lab The Key Sericultural Laboratory of Agricultural Ministry
Street address Tiansheng Road
City Beibei
State/province Chongqing
ZIP/Postal code 086-400716
Country China
 
Samples (182) GSM451052, GSM451053, GSM451054, GSM451055, GSM451056, GSM451057 
Series (2)
GSE18030 MicroRNA expression profiling during the life cycle of the silkworm (Bombyx mori)
GSE18039 MicroRNAs show diverse and dynamic expression patterns in multiple tissues of Bombyx mori

Data table header descriptions
ID probe name
SEQUENCE Oligo sequence of the probe(5'to 3')
miRNA_name name of Corresponding miRNA (ID)
miRNA_ID miRNA name
SEQUENCE miRNA sequence(5'to 3')
POSITION Position on the array. For exmaple, B1-R18-C7/8/9 means block 1-row 1-columns 7 to 9. The positions of the three spots of each probe correspond to the postions on block 1.

Data table
ID SEQUENCE miRNA_name miRNA_ID SEQUENCE POSITION
SW-1 TTTTTTTTTTTTTTTTTACCTCTCTAGAACCGAATTTGTC bmo-miR-10b-3p bmo-mir-10b-3p ACAAAUUCGGUUCUAGAGAGGU B1-R18-C7/8/9
SW-10 TTTTTTTTTTTTTATCATTTCATATGCAACGTAAATACA dme-miR-280 dme-mir-280 UGUAUUUACGUUGCAUAUGAAAUGAUA B1-R2-C4/5/6
SW-100 TTTTTTTTTTTTTTTTTTTCTCACTCAAGGAGGTTGTGA bmo-miR-307-3p bmo-mir-307-3p UCACAACCUCCUUGAGUGAG B1-R17-C4/5/6
SW-101 TTTTTTTTTTTTTTTTTTTGAGAGTCACTAAGTACCTGA dps-miR-306 dps-mir-306 UCAGGUACUUAGUGACUCUCAA B1-R17-C7/8/9
SW-102 TTTTTTTTTTTTTTTTTTTGCCCACCACCTGCTGCATGT bmo-miR-s1 bmo-mir-s1 ACAUGCAGCAGGUGGUGGGC B1-R17-C10/11/12
SW-103 TTTTTTTTTTTTTTTTTTTTCAATGCAACTACAATGCAC bmo-miR-33 bmo-mir-33 GUGCAUUGUAGUUGCAUUG B1-R17-C13/14/15
SW-104 TTTTTTTTTTTTTTTTTTTTGGTTCAGCGATTCATGTTT bmo-miR-322-3p bmo-mir-322-3p AAACAUGAAUCGCUGAACCA B1-R17-C16/17/18
SW-105 TTTTTTTTTTTTTTTTTTTTTCACTACCCATGTCTTTCA bmo-miR-71 bmo-mir-71 UGAAAGACAUGGGUAGUGA B1-R18-C1/2/3
SW-106 TTTTTTTTTTTTTTTTTACTGTCGACGGATAGCTCTCTT bmo-miR-281-5p## bmo-mir-281-5p* AAGAGAGCUAUCCGUCGACAGU B1-R18-C4/5/6
SW-11 TTTTTTTTTTTTTATTACCCGTTAGTGTCGGTCACAAAA dme-miR-274 dme-mir-274 UUUUGUGACCGACACUAACGGGUAAU B1-R2-C7/8/9
SW-12 TTTTTTTTTTTTTCTACGTGTATTCTCAAGCAATAACAT bmo-miR-137# bmo-mir-137* AUGUUAUUGCUUGAGAAUACACGUAG B1-R2-C10/11/12
SW-13 TTTTTTTTTTTTTTAGCCGCGTGTGTCTTATGATAGATT bmo-miR-s2 bmo-mir-s2 AAUCUAUCAUAAGACACACGCGGCU B1-R2-C13/14/15
SW-14 TTTTTTTTTTTTTTATAGGAGAGAGAAAAAGACTGACTA bmo-miR-14# bmo-mir-14* UAGUCAGUCUUUUUCUCUCUCCUAUA B1-R2-C16/17/18
SW-15 TTTTTTTTTTTTTTCACTGCAATGCACTACGGAATTGAA bmo-miR-933 bmo-mir-933 UUCAAUUCCGUAGUGCAUUGCAGUG B1-R3-C1/2/3
SW-16 TTTTTTTTTTTTTTTTTATCACAGCCAGCTTTGATGAGC anti-bmo-miR-2a anti-bmo-mir-2a GCUCAUCAAAGCUGGCUGUGAUA B1-R3-C4/5/6
SW-17 TTTTTTTTTTTTTTCGCGCGCTACTTCAGGTACCTGACT bmo-miR-275# bmo-mir-275* AGUCAGGUACCUGAAGUAGCGCGCG B1-R3-C7/8/9
SW-18 TTTTTTTTTTTTTTCTCCTGCGGCACTAGTACTTAGGAA bmo-miR-252 bmo-mir-252 UUCCUAAGUACUAGUGCCGCAGGAG B1-R3-C10/11/12
SW-19 TTTTTTTTTTTTTTTAAGCTGTTCGAGAATTCTCAGGGA cel-miR-237 cel-mir-237 UCCCUGAGAAUUCUCGAACAGCUU B1-R3-C13/14/15
SW-2 TTTTTTTTTTTTTTTTTACAAATTCGGTTCTAGAGAGGT bmo-miR-10a bmo-mir-10a ACCUCUCUAGAACCGAAUUUGU B1-R18-C10/11/12
SW-20 TTTTTTTTTTTTTTTACATCACACCCAGGTTGAGTGAGT bmo-miR-307-5p bmo-mir-307-5p ACUCACUCAACCUGGGUGUGAUGU B1-R3-C16/17/18

Total number of rows: 106

Table truncated, full table size 11 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap