NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL9545 Query DataSets for GPL9545
Status Public on Jan 04, 2010
Title The Genome Center at Washington University, Candida albicans 20K array
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Candida albicans
Manufacturer The Genome Center at Washington University (http://genome.wustl.edu/services/microarray/candida_albicans).
Manufacture protocol See manufacturer's website
 
 
Submission date Nov 09, 2009
Last update date Jan 04, 2010
Contact name Jessica Lopes da Rosa-Spiegler
E-mail(s) jessica.lopesdarosa@umassmed.edu
Organization name University of Massachusetts Medical School
Street address 364 Plantation street
City Worcester
State/province MA
ZIP/Postal code 01605
Country USA
 
Samples (40) GSM469145, GSM469146, GSM469147, GSM469148, GSM469149, GSM469150 
Series (3)
GSE18936 RNA abundance in wild-type and rtt109 -/- Candida albicans, with and without peroxide stress
GSE50881 Candida albicans response to spaceflight (NASA STS-115)
GSE51064 Transcriptional profiling of Candida albicans cells defective in glucan assembly and undergoing the Yeast to Hyphal transition

Data table header descriptions
ID
SPOT_ID CGD Standard Name
Block Block
Column Column
Row Row
CGD_Systematic_Name
Description
SEQUENCE

Data table
ID SPOT_ID Block Column Row CGD_Systematic_Name Description SEQUENCE
1 orf19.1225_16 1 1 1 orf19.8811 | orf19.8811 | IPF26113.1 | Contig20103:complement(9850..9227)|hypothetical protein CTTCTAGGAATCCTAAATTATATGTTTCAGCATTAATAGCCACTTCAGCAATTGCCCTAACCTAT
2 orf19.1232_57 1 2 1 orf19.8817 VRG4 | orf19.8817 | IPF26079.1 | Contig20104:complement(11354..10014)|GDP-mannose transporter into the lumen of the Golgi TCCAATTCAGGTCCTATTTCTATAGCAGCCTATTGTCTTTCATCTATTTTAATGACAGTCACCAA
3 orf19.1252_1958 1 3 1 orf19.8836 YME1 | orf19.8836 | IPF26065.1 | Contig20104:67978..70116|mitochondrial protein of the CDC48/PAS1/SEC18 family of ATPases CGAACCCATAAACAAGGCTAAAACAATGAGTAATACTGTGATCAAGAAGTCAAGTAAATCTAGTG
4 orf19.1259_3706 1 4 1 orf19.8844 SNT2 | orf19.8844 | IPF26095.1 | Contig20104:complement(91368..87037)|conserved hypothetical protein CTTGTGGTAAACTCAAACCAATACTAGTGTGTCCTAAGCACGATCAATCCAAGAAAACTATTTTA
5 orf19.1280_45 1 5 1 orf19.8867 SUI1 | orf19.8867 | IPF10374.1 | Contig20105:4730..5059|translation initiation factor eIF3 subunit ACTGGTGATTCAGAAGCTCAACCAACAAATTACATTCATATTCGTATCCAACAACGTAATGGTAG
6 orf19.1287_385 1 6 1 orf19.8874 | orf19.8874 | IPF26046.1 | Contig20105:complement(25573..24431)|hypothetical protein GTGGGTTTAGTCCGAGATCTGGTTATCATAGTAGTTCAAGCAGTATATCATCATTATTTTCTCAA
7 orf19.1305_1284 1 7 1 orf19.8885 TRM5 | orf19.8885 | IPF26017.1 | Contig20109:13633..14982|?RNA (guanine) methyltransferase ACAAAACCCATGTTTTGTGTATCGTTTGAACTACCGGAAGAAGTGGCCTTTAAACAAAGTAAATA
8 orf19.1310_1266 1 8 1 orf19.8890 | orf19.8890 | IPF6672.2 | Contig20109:21680..23581|similar to DNA repair protein Rad4 ACAACAGATGGTAAGCTTATTCTCCCGAGAAACAAGTATGGTAACATAGAAATATTCCGTGAAAA
9 orf19.1642_363 1 9 1 orf19.9209 LOC1 | orf19.9209 | IPF25650.1 | Contig20123:78587..79207|nuclear mRNA binding protein TACGACCAAGTCAATGAGAGTAAATTGGAAAAGTCAAGAAGATTAGAAGAGATACGAGACTTGAA
10 orf19.1650_97 1 10 1 orf19.9219 TOM6 | orf19.9219 | IPF15801.2 | Contig20123:89790..90095|mitochondrial outer membrane import receptor subunit AAGCTGCTTTATTTGGTCTTGGTGTTTTGTTCATACAATCACCATTGATGGATATGTTGGTCCCA
11 orf19.1669_1626 1 11 1 orf19.9238 AFG3 | orf19.9238 | IPF25597.1 | Contig20123:complement(140245..137912)|ATP dependent metalloprotease CATTTTGAACAGGCCATAGAAAGAGTTATTGCTGGATTAGAAAAGAAATCTCGTATTTTGTCTCC
12 orf19.1675_1130 1 12 1 orf19.9244 | orf19.9244 | IPF14225.2 | Contig20123:complement(160653..159451)|conserved hypothetical protein GGTCATTACATTTACAGTTAGTTTGTTAAGAGTTATTGATAGAGTGAATACTCCAGGACCCAGAA
13 orf19.1697_858 1 13 1 orf19.9264 | orf19.9264 | IPF25640.1 | Contig20123:202016..203077|conserved hypothetical protein ATTTTGGAGAAGTTCTCTGATAAATACTATACTGAAGAAGATAACGGGGAAACTTGGGATTTATC
14 orf19.1702_421 1 14 1 orf19.9269 ARF3 | orf19.9269 | IPF25666.1 | Contig20123:complement(210697..210209)|GTP-binding ADP-ribosylation factor CAACAATTGCAATTGATGGTACTGGGTTAGTTGAAACCTTGAATTGGATTTCATCGCATTCCAAG
15 orf19.1721_514 1 15 1 orf19.9289 NCE103 | orf19.9289 | IPF25642.1 | Contig20123:249419..250315|conserved hypothetical protein CAAAGAAAAAAATTGGTGGTGTTTTAGATTTATGGTTAAATCCAGTTAGACATATTCGTGCTGCT
16 orf19.1728_16 1 16 1 orf19.9296 | orf19.9296 | IPF25653.1 | Contig20123:264339..264971|hypothetical protein GAACATCAATATCTTTTAATCAAGATAATTTCAAAATCTTGGTATTTTTCATTATCCCCATATTA
17 orf19.207_3938 1 17 1 orf19.7838 | orf19.7838 | IPF15911.3 | Contig20045:26617..30108|extremely serine rich protein TCAATCTGATACAGTATATTACACGATTGTTTCTGGTGAAACTAAGACTATTCAAACACCCGGAT
18 orf19.2075_711 1 18 1 orf19.9622 DFG5 | orf19.9622 | IPF25260.1 | Contig20139:complement(153548..152193)|filamentous growth, cell polarity and elongation GCTAAGATTACTAATAACTGTAGTTCTGTGACTGACTTGAGATGGTCTTACACATATGGTGTATT
19 orf19.2097_2420 1 19 1 orf19.9644 RAD5 | orf19.9644 | IPF25340.1 | Contig20139:complement(192097..188843)|ATPase/DNA helicase CGGAAAAATCAAAGAAGAAAACGAATGTTCTATATGCACACAAGTACCTATCCCATATAGTGAGA
20 orf19.2102_127 1 20 1 orf19.9650 CKB1 | orf19.9650 | IPF25288.1 | Contig20139:200493..201374|casein kinase II, regulatory (beta) subunit CTCTGCAAGTACCTTATTATAGAGAAGCATTATACACAATATTGGATTACCAAGTTGAAACGGCA

Total number of rows: 20160

Table truncated, full table size 3639 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL9545.gal.gz 319.6 Kb (ftp)(http) GAL

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap