 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 30, 2019 |
| Title |
ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX] |
| Organism |
Homo sapiens |
| Experiment type |
Other
|
| Summary |
We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
|
| |
|
| Overall design |
generationa and modeling of aptamers against amyloid-β peptide and its mechanism of action.
Please note that the raw data corresponding for the aptamers were submitted which is required for the study (rest of the readings/files are discarded) and since the resulting raw data contains only 4 lines with 23 or 64 bp reads, they are included as GEO sample supplementary files.
|
| |
|
| Contributor(s) |
Maroli N |
| Citation missing |
Has this study been published? Please login to update or notify GEO. |
| |
| Submission date |
Jan 09, 2019 |
| Last update date |
Jun 14, 2023 |
| Contact name |
Nikhil Maroli |
| E-mail(s) |
scinikhil@gmail.com
|
| Phone |
7200515138
|
| Organization name |
DRDO BU CLS
|
| Department |
Physics
|
| Lab |
Computational Biology
|
| Street address |
Bharathiar University
|
| City |
Coimbatore |
| State/province |
TAMIL NADU |
| ZIP/Postal code |
670691 |
| Country |
India |
| |
|
| Platforms (1) |
| GPL16288 |
AB 5500xl Genetic Analyzer (Homo sapiens) |
|
| Samples (3) |
|
| Relations |
| BioProject |
PRJNA514043 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSE124865_RAW.tar |
140.0 Kb |
(http)(custom) |
TAR (of FASTQ, PDB, TXT) |
| Raw data provided as supplementary file |
| Processed data provided as supplementary file |
|
|
|
|
 |
