|
| Status |
Public on Apr 27, 2013 |
| Title |
het_CG5508_ovaries_smallRNA |
| Sample type |
SRA |
| |
|
| Source name |
ovaries
|
| Organism |
Drosophila melanogaster |
| Characteristics |
tissue: ovaries
age: 3-5 days old flies
strain: heterozygous z3-5967 (GC5508 mutant)
|
| Growth protocol |
Fly stocks were maintained at 25 ºC in standard conditions
|
| Extracted molecule |
total RNA |
| Extraction protocol |
total RNA was size selected (19-28nt)
libraries were prepared according (Malone et al. Cold Spring Harb Protoc. 2012 )
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
19-28 nt size fractionated RNA
|
| Data processing |
clip 3' end adaptor GATCGGTACAGTTGCAGTAAGAGC, keep reads with min length 15nt
collapse reads
remove low-complexity reads and artifacts
map to genome
Genome_build: Release 5 (dm3)
Supplementary_files_format_and_content: tabular files with all mappers, their reads number and genomic annotation
|
| |
|
| Submission date |
Apr 26, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Vasily Vagin |
| E-mail(s) |
vagin@cshl.edu
|
| Organization name |
Cold Spring Harbor
|
| Lab |
Hannon's
|
| Street address |
1 Bungtown Rd
|
| City |
Cold Spring Harbor |
| State/province |
NY |
| ZIP/Postal code |
11724 |
| Country |
USA |
| |
|
| Platform ID |
GPL9061 |
| Series (2) |
| GSE46422 |
Minotaur is critical for primary piRNA biogenesis [smallRNA-Seq] |
| GSE46424 |
Minotaur is critical for primary piRNA biogenesis |
|
| Relations |
| BioSample |
SAMN02058429 |
| SRA |
SRX272100 |
