NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1129994 Query DataSets for GSM1129994
Status Public on Apr 27, 2013
Title hom_CG5508_ovaries_smallRNA
Sample type SRA
 
Source name ovaries
Organism Drosophila melanogaster
Characteristics tissue: ovaries
age: 3-5 days old flies
strain: homozygous z3-5967 (GC5508 mutant)
Growth protocol Fly stocks were maintained at 25 ÂșC in standard conditions
Extracted molecule total RNA
Extraction protocol total RNA was size selected (19-28nt)
libraries were prepared according (Malone et al. Cold Spring Harb Protoc. 2012 )
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer II
 
Description 19-28 nt size fractionated RNA
Data processing clip 3' end adaptor GATCGGTACAGTTGCAGTAAGAGC, keep reads with min length 15nt
collapse reads
remove low-complexity reads and artifacts
map to genome
Genome_build: Release 5 (dm3)
Supplementary_files_format_and_content: tabular files with all mappers, their reads number and genomic annotation
 
Submission date Apr 26, 2013
Last update date May 15, 2019
Contact name Vasily Vagin
E-mail(s) vagin@cshl.edu
Organization name Cold Spring Harbor
Lab Hannon's
Street address 1 Bungtown Rd
City Cold Spring Harbor
State/province NY
ZIP/Postal code 11724
Country USA
 
Platform ID GPL9061
Series (2)
GSE46422 Minotaur is critical for primary piRNA biogenesis [smallRNA-Seq]
GSE46424 Minotaur is critical for primary piRNA biogenesis
Relations
BioSample SAMN02058430
SRA SRX272101

Supplementary file Size Download File type/resource
GSM1129994_processed_hom_CG5508_ovaries_smallRNA.finalann.txt.gz 14.3 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap